GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:22:34, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_030273244            5424 bp    mRNA    linear   VRT 09-AUG-2019
DEFINITION  PREDICTED: Taeniopygia guttata ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_030273244
VERSION     XM_030273244.1
DBLINK      BioProject: PRJNA558048
KEYWORDS    RefSeq.
SOURCE      Taeniopygia guttata (zebra finch)
  ORGANISM  Taeniopygia guttata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Estrildidae; Estrildinae; Taeniopygia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044211.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Taeniopygia guttata Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5424
                     /organism="Taeniopygia guttata"
                     /mol_type="mRNA"
                     /isolate="Black17"
                     /db_xref="taxon:59729"
                     /chromosome="1"
                     /sex="male"
     gene            1..5424
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:100219575"
     CDS             299..4291
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030129104.1"
                     /db_xref="GeneID:100219575"
                     /translation="
MERKLDNKMKRELSCLATLNDRNISLVSIRKQQAACDVPELLIIGEKSKTASPVKASSNLQKEEKVLRSYSTGMTEVNTDERQALSNIDSPPGCELKPTMKHKFAFDNMGYEESSENMSSPPSQEHTVVVNIVGMTCQSCVQSIEGRICKVKGILRIKVSLEQNNAVIKYLQLEISPEQICQEILDMGFDANIAEEKLTTATVNLPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETSASLESDGLDLLVPEMGSTATVTAQIEGMHCKSCVRNIEGNISDLPGIKCIKVSLENKCAVVQYSPDLITLSALQQAIESLPPGNFKVSLLSGSEANKAASCSGAFTYNVIRQPPQGTTHMAVIKIDGMTCNSCVKSIEGAISQRQGVQHVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTATGEKRCQPDASKAAVQPQAPEPPRQGNASEALPDSPHPEGSNQLSGAREEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPKLIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLFSLVFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYLYSCIILIVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIEGNSMADESLITGEPMPVIKKPGSTVIAGSINAHGSLLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTERLGYCTDFQAVPGCGISCKVGGVEAILGIAEEGPNELDANRSGVSSAPLGDNRVITLLESQGPSTSQKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVSHHTADSASTVVCTFCALRSVLFLCVML"
ORIGIN      
ccgtgtgcagagatcagcagtgccggacgcagttgggaaagcacgaggatgccaattggtgggaaacatttaaactggcagggagagcaggtagctgagtgcagcaagcagcctacgtgaggatcacaggttgcatctgggatttcctgatgaatgcctaatgagcccatggattagacgggcagaactcttcaagctgctgtaaatgtagttgaaagaagcgtggcttgtaggacaccaaataactgctctcgtgaaaccttttttggcattgcagtatttaaagaccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctgcttagctactttaaacgacagaaacatatccttggtgtctattcgtaagcagcaggcagcttgtgatgtgcctgaactactgattattggtgaaaagtccaagacggcatctccggtaaaagcaagcagtaacttgcagaaagaagagaaagttttgcggagttactccacgggaatgacagaagtcaatacagatgaaaggcaggctttgtccaacatcgattctcctcctggttgtgagctgaagcctacaatgaaacataaatttgcttttgacaacatgggctatgaggagagctctgaaaacatgtcctctccaccttcccaagagcatactgtggtagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcaatagaaggccgaatttgcaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatctgcagttggaaataagccccgaacagatttgccaggaaattctggatatgggctttgatgccaatatagcagaagagaagttgacaacagcaactgtaaatttgccaagcttgaaagaagcggtagctaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagataaggaaactgcatggtgtagcaaaaatcaaggtgtcacttgataaccaagaagcaattattgcttaccatccttacatcattcagcccgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcggcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccctagggagacatctgcaagtcttgagagtgatgggctggatctgctggtccctgagatgggtagcacagcaacagtgactgcacagatagagggcatgcactgcaagtcctgtgtcagaaatatcgaaggaaatatatcagatcttcctggcataaaatgtattaaagtgtctttggagaataaatgtgctgtggtacagtatagcccagatttaatcaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttgctcgggtgctttcacatacaatgtcatcagacagccaccacaaggcacgacacatatggctgttattaagattgatggcatgacctgcaattcttgtgtgaagtccatagaaggggccatatcacagaggcagggagtgcagcacgtggcagtttctcttgctggcagtactgggaccatacactatgatccagctgtcactagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtgctgacagatactgccactggagaaaagaggtgccagcctgatgccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggcaatgcctcggaagctcttccagacagtcctcaccctgaggggtcaaaccagctcagtggagccagagaagaaaagtgtgttttacagatcacaggcatgacttgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtattggtagcactgatggcaggtaaagcagagataaaatacaagccaaaactcatacaacctcttgaaatagcacagctgatccagaatttgggttttgaagctaccattatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggtccacgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataatctgagtcataaaaaggaaatacagcagtggaggaaatctttcttattcagcctagtgtttggtatcccagttgtagtcctaatgatttatatgcaaatacccaatggtgaagaccacgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttcttttctttatcctgtgcacttttgttcagttccttggtggatggtatttttacgtacaagcttacaagtcactgaggcacaagacagccaatatggacgtgctcatcgtgctggccacgacgattgcttatctgtattcctgcatcatcctgatagtagcaatcattgaaaaggcagagaaaagccctgtcactttcttcgacacgcctccgatgttgtttgtgttcattgcgctcggcagatggctggaacacatagccaagggtaagacctctgaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcaaaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcaattctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcacttcttgttaatgcaacgcatgttggtaatgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagtatggatcacaattggttttgtaaattttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcgcagaatggtattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggcgttcctaaagtcatgagagtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggcggttgttggtacagcagaagccagcagtgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagaggctgggatactgcactgacttccaggcagtcccaggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcatagctgaggaaggtcccaatgagctggatgctaacaggagtggggtcagcagtgctcctctgggagataacagagttatcacgctcttggaatcacaaggtccatcaacttctcagaaatattcggtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaacgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgatcgcaatagcagacacagtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagatgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggtatcccaccacacagctgactcagccagcactgtggtatgcacgttctgtgctctgaggtctgttttgtttctctgtgtgatgctttaatcctcctcctattggctttcatacttttgcttttgtgttcagttatgaaaaagtgctttcccaccccattttctttgtcaaggaaaaaagtctttcagaaacaagcttgaatttaggattccaggaacaaagatgaatgttttaaacaagcttagtttgtgtcaacctacattttcattgaatttttggaacatactgtccaatggaaagaaatggtaaacagtttaaaaactgttataaaatgctactttttaaaaagttaaaagagagcttctgtcttatgtggtgaaaagctgcttctgcctggtgaggcagccaaacagagggcattatcccagcactatttaatatactcatctgtttttcaactacaacactggagccattgctagcaactcgaaataagttatgatgtggatgggtagaatcatttagccagccatctgctttattttcataatctccctgagacctgcacatacttgttgtctctgtgttttccctgctgtaactgcttgatcatacatggttcgtgtgttgcattatctgcttgaaggctctgcagaaggatctggacaggctggattgatgggctgaggccagttgtgtgagattcaaaagggtgaaggatcaagtcctgtgcttgagtcataacaacccctgcagaactgcaggctgggggcagagtggctgaaaagctgctcagcagaaaatgacctgggggtgctgcttgacagcagctgaacatgagccagcactgtgtccaggtggccaagaaggtcaatggcatcctgacctgtatcagcaacagtgtggtcagcaggactaagggaagtgttagagtcactacccctgaaggtatttaaaagacaaatctttattgctggggcagtggagctccagaagccacgcagggcatgatttgaagggcagagtatggtttgccagcatctctgcagcaggagggtgctgttatcaatcctgttcttatgccaaaggcgtgttgttcttcagttttctgtgtagctagcaagtgttgtcttcaccagaatcagtttggttgccttcacctagaacagcaaatggctcttccttccagcatgaagcatgtcaccaacagggtgtctttcttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]