LOCUS       XM_030136129            1911 bp    mRNA    linear   VRT 02-AUG-2019
DEFINITION  PREDICTED: Sphaeramia orbicularis flocculation protein FLO11-like
            (LOC115420685), mRNA.
ACCESSION   XM_030136129
VERSION     XM_030136129.1
DBLINK      BioProject: PRJNA556027
KEYWORDS    RefSeq.
SOURCE      Sphaeramia orbicularis (orbiculate cardinalfish)
  ORGANISM  Sphaeramia orbicularis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Gobiaria; Kurtiformes; Apogonoidei; Apogonidae;
            Apogoninae; Sphaeramia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_043962.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sphaeramia orbicularis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1911
                     /organism="Sphaeramia orbicularis"
                     /mol_type="mRNA"
                     /db_xref="taxon:375764"
                     /chromosome="6"
     gene            1..1911
                     /gene="LOC115420685"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:115420685"
     CDS             190..1641
                     /gene="LOC115420685"
                     /codon_start=1
                     /product="flocculation protein FLO11-like"
                     /protein_id="XP_029991989.1"
                     /db_xref="GeneID:115420685"
                     /translation="

MSPNPSTLHPRPSVCFLLLLLLLTPSSCTSARKDPLQPSPETTDQNQAEAETWDRSQSETETLNQSQGETETQTQNQGQSQSETENQNQSQGETETQNQNHSQSETETLNQSQTETLNQSQTETLNQSQTETFNQSQSETETLNQSQSETETLNQSQNETEAQVKNENQTQVENTTQAGTQSQAKTQNQDRTQAETGNQNQTRVEVETHTQVATLNQIQAETQNQLNTTQGGDVGIGNAAELDSSDAALNISPSVPDLNDTSHVLVPSPDSMENTPELDLSGPYKNHTSVRHQLNDSTASLRPPEPSPTVPPNQQPAAPNDTGHYANATVPDQQTVHPDLGVGTSPTTTTTTTSTTTTTASTTMTTTTVAPPPPTTAKPTPTTHTTSLQTPPPTLQPKPAVPVPTSTPSRPATPSVAVVEMAGGALSRQLVDTASLLAVLLFGLLFFLVTVAVFVTQAYESYRRKDYTQVDYLINGMYTDSGV"

     misc_feature    322..>879
                     /gene="LOC115420685"
                     /note="Fibrinogen binding protein; Region: Fibrinogen_BP;
                     pfam08017"
                     /db_xref="CDD:311808"
     misc_feature    <1546..1632
                     /gene="LOC115420685"
                     /note="Family of unknown function (DUF5585); Region:
                     DUF5585; pfam17823"
                     /db_xref="CDD:436069"
ORIGIN      

agaactgaacaggaagtgttgagtttacatgtttagcctggacaagtgtccctgctctaaaccttaaactgatgagtaaccacacatcgctgctcctgccgttgtgtgttcatgtgaggttgtgtttgtgagttggtgtgtgtgtgtgtgagtgtgtgtgtgtgttgtgtgtcatcagccccacccatcatgtccccaaacccatcgacgctccacccacgtccatcagtgtgttttctcctcctcctgctcctgctcaccccctcctcctgcacgtcagcccggaaagacccgctccagcccagccccgagaccacagaccagaaccaggctgaggccgagacctgggaccggagccagagcgagactgagaccttgaaccagagccagggtgagactgagacccagacccagaaccagggccagagccagagtgagactgagaaccagaaccagagccagggtgagactgagacccagaaccagaaccacagccagagcgagactgagaccttgaaccagagccagactgagaccttgaaccagagccagactgagaccttgaaccagagccagactgagacctttaaccagagccagagtgagactgagaccttgaaccagagccagagtgagactgagaccttgaaccagagccaaaatgagactgaggcccaggtcaagaacgagaaccagacccaggtcgagaacacgacccaggccgggacccagagccaggctaagacccagaaccaggaccggacccaggctgagaccgggaaccagaaccagactcgggtagaggttgagacccatacccaggtcgcaaccttgaaccagatccaggccgagacccaaaaccagctcaacacaacgcaaggtggtgatgttggcattggaaatgcagccgagctggactccagtgatgcggcgttgaacatttcgccttctgttccagacctgaatgacaccagccacgttctcgtcccgtctcctgattctatggaaaacactcctgaactggacctaagtggaccgtacaagaaccatacctctgtcagacaccagttaaatgactctacggcgtccctcagacctccggagccttcgcccaccgtgccacccaatcagcagccagcggcgccaaatgacacgggtcactatgccaatgccacagtccccgaccaacagactgttcatcctgacctgggtgtcggcactagtcccactacgaccaccaccacgacatctacaaccacgacgacagcatctacaaccatgacaacaacaacagtggctccgccccctccgaccacagcaaaaccaacacccacgactcataccacctccttacagactccgccccccacactgcagcctaaaccagcggtcccagtcccgacgtccactccttcccgtccagcgacccccagcgttgccgtggtggagatggcgggcggagctctgagccggcagctggtggacacggcgtcactgctcgccgtcctgctctttgggttgctcttcttcctggtcacagtggcggtgttcgtcacgcaggcctacgagagctaccggaggaaggactacacgcaggtggactacctgatcaacggcatgtacaccgactctggggtctgacgcagcgagggggcggggtttgtccatgtgggcaggaccggtggcagctgtggagatgtgtttggagtcagactccaagacgaggtgatccagagaaaccaggacctgaagcaggacctgaaccaggatctgtgtgtcataacctttttcacatagtgctttgttcgatcattcttctcctgaatgtaatgagtttgtcctgttttcttttcctgaacataaacggctgaagcagacgtttcctctacttacaccacgttcacattgcag

//