2024-05-05 09:30:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_030136129 1911 bp mRNA linear VRT 02-AUG-2019 DEFINITION PREDICTED: Sphaeramia orbicularis flocculation protein FLO11-like (LOC115420685), mRNA. ACCESSION XM_030136129 VERSION XM_030136129.1 DBLINK BioProject: PRJNA556027 KEYWORDS RefSeq. SOURCE Sphaeramia orbicularis (orbiculate cardinalfish) ORGANISM Sphaeramia orbicularis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Gobiaria; Kurtiformes; Apogonoidei; Apogonidae; Apogoninae; Sphaeramia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_043962.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Sphaeramia orbicularis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1911 /organism="Sphaeramia orbicularis" /mol_type="mRNA" /db_xref="taxon:375764" /chromosome="6" gene 1..1911 /gene="LOC115420685" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115420685" CDS 190..1641 /gene="LOC115420685" /codon_start=1 /product="flocculation protein FLO11-like" /protein_id="XP_029991989.1" /db_xref="GeneID:115420685" /translation="
MSPNPSTLHPRPSVCFLLLLLLLTPSSCTSARKDPLQPSPETTDQNQAEAETWDRSQSETETLNQSQGETETQTQNQGQSQSETENQNQSQGETETQNQNHSQSETETLNQSQTETLNQSQTETLNQSQTETFNQSQSETETLNQSQSETETLNQSQNETEAQVKNENQTQVENTTQAGTQSQAKTQNQDRTQAETGNQNQTRVEVETHTQVATLNQIQAETQNQLNTTQGGDVGIGNAAELDSSDAALNISPSVPDLNDTSHVLVPSPDSMENTPELDLSGPYKNHTSVRHQLNDSTASLRPPEPSPTVPPNQQPAAPNDTGHYANATVPDQQTVHPDLGVGTSPTTTTTTTSTTTTTASTTMTTTTVAPPPPTTAKPTPTTHTTSLQTPPPTLQPKPAVPVPTSTPSRPATPSVAVVEMAGGALSRQLVDTASLLAVLLFGLLFFLVTVAVFVTQAYESYRRKDYTQVDYLINGMYTDSGV"
misc_feature 322..>879 /gene="LOC115420685" /note="Fibrinogen binding protein; Region: Fibrinogen_BP; pfam08017" /db_xref="CDD:311808" misc_feature <1546..1632 /gene="LOC115420685" /note="Family of unknown function (DUF5585); Region: DUF5585; pfam17823" /db_xref="CDD:436069" ORIGIN
agaactgaacaggaagtgttgagtttacatgtttagcctggacaagtgtccctgctctaaaccttaaactgatgagtaaccacacatcgctgctcctgccgttgtgtgttcatgtgaggttgtgtttgtgagttggtgtgtgtgtgtgtgagtgtgtgtgtgtgttgtgtgtcatcagccccacccatcatgtccccaaacccatcgacgctccacccacgtccatcagtgtgttttctcctcctcctgctcctgctcaccccctcctcctgcacgtcagcccggaaagacccgctccagcccagccccgagaccacagaccagaaccaggctgaggccgagacctgggaccggagccagagcgagactgagaccttgaaccagagccagggtgagactgagacccagacccagaaccagggccagagccagagtgagactgagaaccagaaccagagccagggtgagactgagacccagaaccagaaccacagccagagcgagactgagaccttgaaccagagccagactgagaccttgaaccagagccagactgagaccttgaaccagagccagactgagacctttaaccagagccagagtgagactgagaccttgaaccagagccagagtgagactgagaccttgaaccagagccaaaatgagactgaggcccaggtcaagaacgagaaccagacccaggtcgagaacacgacccaggccgggacccagagccaggctaagacccagaaccaggaccggacccaggctgagaccgggaaccagaaccagactcgggtagaggttgagacccatacccaggtcgcaaccttgaaccagatccaggccgagacccaaaaccagctcaacacaacgcaaggtggtgatgttggcattggaaatgcagccgagctggactccagtgatgcggcgttgaacatttcgccttctgttccagacctgaatgacaccagccacgttctcgtcccgtctcctgattctatggaaaacactcctgaactggacctaagtggaccgtacaagaaccatacctctgtcagacaccagttaaatgactctacggcgtccctcagacctccggagccttcgcccaccgtgccacccaatcagcagccagcggcgccaaatgacacgggtcactatgccaatgccacagtccccgaccaacagactgttcatcctgacctgggtgtcggcactagtcccactacgaccaccaccacgacatctacaaccacgacgacagcatctacaaccatgacaacaacaacagtggctccgccccctccgaccacagcaaaaccaacacccacgactcataccacctccttacagactccgccccccacactgcagcctaaaccagcggtcccagtcccgacgtccactccttcccgtccagcgacccccagcgttgccgtggtggagatggcgggcggagctctgagccggcagctggtggacacggcgtcactgctcgccgtcctgctctttgggttgctcttcttcctggtcacagtggcggtgttcgtcacgcaggcctacgagagctaccggaggaaggactacacgcaggtggactacctgatcaacggcatgtacaccgactctggggtctgacgcagcgagggggcggggtttgtccatgtgggcaggaccggtggcagctgtggagatgtgtttggagtcagactccaagacgaggtgatccagagaaaccaggacctgaagcaggacctgaaccaggatctgtgtgtcataacctttttcacatagtgctttgttcgatcattcttctcctgaatgtaatgagtttgtcctgttttcttttcctgaacataaacggctgaagcagacgtttcctctacttacaccacgttcacattgcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]