GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:25:22, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_029140035            3843 bp    mRNA    linear   VRT 24-APR-2021
DEFINITION  PREDICTED: Betta splendens NRDE-2, necessary for RNA interference,
            domain containing (nrde2), mRNA.
ACCESSION   XM_029140035
VERSION     XM_029140035.2
DBLINK      BioProject: PRJNA522468
KEYWORDS    RefSeq.
SOURCE      Betta splendens (Siamese fighting fish)
  ORGANISM  Betta splendens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Anabantaria; Anabantiformes; Anabantoidei;
            Osphronemidae; Betta.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_040900.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 24, 2021 this sequence version replaced XM_029140035.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Betta splendens Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3843
                     /organism="Betta splendens"
                     /mol_type="mRNA"
                     /db_xref="taxon:158456"
                     /chromosome="22"
     gene            1..3843
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 25 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:114849029"
     CDS             85..3609
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_028995868.1"
                     /db_xref="GeneID:114849029"
                     /translation="
MALFPAFAEVSSNKLEDSSKELDWLNNKSFQTGHAISLHSRFLEKESSVSRDVSSADERQEEKSNVPPKRKKQKKTEQKRKKKKKHRKKSGRYSDSSGPDSDTIYPSDLKKEYEGQRSQAAPLASRFSWLDDVQSPTEQTFCVDRKPDPANWTYKSLYRGDVARYKRKGSSSLGLDLRRQEIRWEESEKKKGADKKKSADRYFSTVTRQILRSEPPLPTLPTKPEGSNVIKSSFLPLGDTEDKKRVETSARMQTSSENPLGVYDSSTSLWLQGKGQQDQQEEDGQTDLSAVLLAKKTEEFNRQLREQPADTQLWIKFIKYQDELSTVFGGKEEQLGTDAVEQRKSSYKAVLEKKLSIAERAVATNPKCIVLQLERLKICQELWEPSALAKEWKKLVFLHPNSAPLWKKYLLFTQSYFSNFSVSKVNSAYGKCLSTLSAVRDGSMVSHPALPGTEEDMLDIFAQQCHFLRQSGHSEKAITLFQAMIDFTFYKPDSVRKLSTKQQVDFFEPFWDSGEARIGELGARGWKAWMVQQERGGWIQPNAEEEEEDEEEEEEEVKDQSQPRWTVWLDVESSRDAAQWLPWRPDKSKGQTEEDCEDPDRQVLFDDIGPSLICLSSPDLQLHLLLWFLSFLGLPVDSVFSDALCQSDLLLENLSLLTQGTDLQHPLTSHDLPDLGINAVGHMTTLQGTKKLAGLGKHGERFVTNVFNMVQAFLPTHHRAVLSLCWMQYEKVKVFHCLQGSNKKRLRSQGKRSKRVAKRLLKEPENRSSLVLWREYAHMEWMLGNLDEARKVFSTATAMGGTEGLSSPSFCELCLLWAQLEVEDCTTVRGGRLKDVTASPAVSVLTKLADGNSSFTPASPQSISPVSILKARKAYEQALSAGLSVLDENPNSPPSGKKGPETLRLRGLVGCSALFQYLTVGISAANEVYSQARGKMEELHHKLTNSDGEAECARAEFTYITKLASECKVLAVQQAALLRYHNSVIVFPLATLRHTLTSALSSWPSSTTLWSIYVQVENHYHSAGRARRFFHSVTKDSNSVVPHLFAIVAEQQRKQLVDAAQRSCSHDVALPILPENGLSHRIRRLFENAIASEMGAHCPLLWRMYMHFLVSEGKVDKARGIFYRALQNIPWAKGLYMDAVQLFPEHLQEFTDLMMEKELRLRLPLEELDILLEN"
     misc_feature    979..1803
                     /gene="nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:337049"
ORIGIN      
aatagttgtttgataaccgttaaaaaatagaggaagaagaaatgacgtcatgtttctgcgactgtttttatcaaacaagctatcatggcgctgtttccagcttttgctgaagtgtctagtaacaaacttgaagattcttccaaagaattagactggctgaataacaagagctttcagaccgggcatgccatttctcttcacagtcgatttttagagaaggagtcaagtgttagcagagatgtgagctctgcagatgagaggcaggaggagaaaagcaatgttccacctaaaaggaagaagcagaagaaaacggaacagaagaggaaaaaaaagaagaagcacagaaagaagagtggtagatattcagatagcagtgggcctgactctgacacaatttaccccagtgacctcaaaaaggaatatgagggacaaagatctcaggcggccccattagcgagtcgtttttcctggttggatgacgtccaatctcccacagaacaaacattctgtgtggaccgaaaaccagacccagccaactggacgtacaagtcactatacagaggggatgtagcaaggtataagaggaaaggcagctcatcgttaggcctagaccttcgcagacaggaaatcaggtgggaggaatcagagaagaagaaaggtgcggacaagaaaaaatcagcagacagatacttctctacagtcactcgtcagatactgagatctgagccccctcttcctacgttaccaacaaaacctgagggcagtaatgttatcaaatcctcgttcctcccactgggggacactgaggacaagaaacgtgtagagacaagtgcaagaatgcagacatcatcagaaaatcccctcggtgtgtatgactcctccacatccctctggctgcaggggaaaggacagcaggaccagcaggaggaggacggtcagacagacctgagtgctgtgcttttggccaaaaagactgaagagtttaacagacagctcagggagcagcctgcagatacacagttgtggataaaattcataaaataccaggacgagctttcaacagtctttggtggtaaggaggagcagctgggcactgatgcggtagagcagcgtaaatcttcctacaaagcggtcctggagaaaaagctgagcatcgcagagcgggcagtggccaccaaccctaaatgcatagttttgcagctggaacggctcaagatctgccaagagctctgggagccctctgctttggctaaagaatggaagaaactggtgttccttcatccaaacagcgcccccttgtggaagaagtatctgcttttcacccagagctactttagcaatttctctgtgtcaaaggtcaattctgcctatggaaagtgcctaagcactctcagcgctgtaagagatggcagcatggtctctcaccccgcactgccagggactgaggaggacatgttggatatttttgcacagcagtgtcatttcttgcgtcagtcgggtcactctgagaaggcgattactctatttcaagccatgatcgactttactttctacaaacccgacagtgtacgaaagctgtccaccaagcagcaggttgacttctttgagcctttctgggatagtggggaggcgaggattggggagttgggggcccggggttggaaagcctggatggtccaacaagagcggggaggttggattcagcccaatgcagaggaagaagaggaggatgaagaggaggaggaggaggaggtgaaggatcagagccagcccagatggacagtctggctggatgtggaatcgtcccgtgatgcagctcagtggcttccctggaggcctgataaatccaagggccaaacagaagaagactgtgaagaccctgacagacaggtgttgtttgatgacattggtccatccttaatttgtctgtcgtcaccggatcttcagctccatcttctcctctggttcttgtcattcctgggtctccctgtggactctgtcttctctgatgccctctgtcagtctgacctgttgctggagaacctttcactgctcactcagggtactgacctccagcatcctctgacctcccatgacctacctgaccttgggattaatgctgtaggtcacatgaccacactacaagggacaaagaagttggcaggactgggcaaacatggtgagaggtttgtcaccaatgtgtttaacatggtccaagcctttcttcccacacaccaccgagctgtcctgtcactctgctggatgcagtatgagaaagttaaagtctttcactgtctgcaaggcagcaacaaaaagcgtcttcgctctcagggcaagagaagtaagcgggttgccaagcgactgctcaaagaaccggaaaaccgctcgtcactggtcttgtggcgggagtatgcccatatggagtggatgctgggcaacctcgacgaagcacgcaaagttttctccacagcaactgcaatgggtggaaccgaagggctaagtagccccagtttctgcgagctgtgtctgctatgggcacagctagaggtggaggactgcacaactgtgcgaggagggagattgaaggacgtaacggcttccccagctgtctctgtgctaacaaagctagctgatggaaactcctcattcactccagcatccccccagtccatctcccctgtttccattctgaaagctagaaaggcatatgaacaggctctatcagctggcttgtcagtgctggatgagaaccccaacagtcctccgtccggaaaaaaaggtccagagacgctgagactgagaggcctggtcggctgctctgctctgttccagtacctcacagtgggcatatctgcagctaatgaagtctacagccaagctagggggaaaatggaggagttgcatcacaaattaacaaacagtgatggggaggcagagtgtgctagggctgagttcacatatatcaccaagcttgcttctgagtgtaaagtactagcggtacagcaggccgcgttgctaaggtaccataacagcgtcattgtgtttcccctggcaacactaagacacactctgacctctgccctctccagctggcccagcagtaccacactgtggagcatatatgtacaggttgagaaccattaccatagtgctggccgggccagacgtttttttcattcggtaaccaaggacagcaacagtgtggttccacacctatttgctattgttgctgaacaacaaaggaagcagctggtggatgctgctcagaggtcttgttctcatgatgttgctttgcccatcctgccggaaaatggtctcagccaccgtattcgcagactgtttgaaaacgctatagcatcggagatgggtgctcactgtcctttactttggaggatgtacatgcatttcttggtgtccgaagggaaggtcgataaagccagggggatcttctacagggctttacaaaatatcccctgggcaaagggtctgtacatggacgccgtgcagctgttccctgagcatctgcaggagttcaccgatctgatgatggagaaagagctgcgtctcaggctgcctttggaagaactggacatattactggaaaactgatcacacacacggactttagaacaatcaagacttcactttgagcttgctttaatggccaagcgctgactcgcatacaggacacaaacccagatgcttctacacacaccttctctctgaactacactgagaaaatattgtgctgctctgtacataaatcctgaaaataagttgtattctacagcaaatacaactaagttttggtacctgacattgtcaataaatatactagtatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]