LOCUS       XM_028744516            2344 bp    mRNA    linear   VRT 21-APR-2019
DEFINITION  PREDICTED: Podarcis muralis pre-mRNA-splicing factor cwc25-like
            (LOC114604422), transcript variant X1, mRNA.
ACCESSION   XM_028744516
VERSION     XM_028744516.1
DBLINK      BioProject: PRJNA529705
KEYWORDS    RefSeq.
SOURCE      Podarcis muralis (Common wall lizard)
  ORGANISM  Podarcis muralis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Laterata; Lacertibaenia; Lacertidae; Podarcis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041320.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Podarcis muralis Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2344
                     /organism="Podarcis muralis"
                     /mol_type="mRNA"
                     /db_xref="taxon:64176"
                     /chromosome="9"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /ecotype="yellow"
     gene            1..2344
                     /gene="LOC114604422"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:114604422"
     CDS             107..1972
                     /gene="LOC114604422"
                     /codon_start=1
                     /product="pre-mRNA-splicing factor cwc25-like isoform X1"
                     /protein_id="XP_028600349.1"
                     /db_xref="GeneID:114604422"
                     /translation="

MFKYDGLESARGQYSHFKKCDELRQRYPDWNPEEFSLLQRHEGDKKEKHIPMPCSTSSNPNTSQHSIPGHASSQTRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSPGPHSRKRSRSRSHRHRSRSSERRSSPSSSSQTSASQKRELRKSTRSPASSAEAGSSRKPPAKSDAAEQPPKKSEHPLQTNPGHQEPPKKEVAMREQGDQQLPSKSDVAKQPPNKSDQPLLTNPGHQELPKKEAATQEQADRQPPAKSDVAEQPPKKSEHPLQTNLDHQELPKMEAATQGQGDRQREDHMRFSLTPFVEQSVMQALSLLQPGGTVGAGLTQGTSLPPLPALQIEAASLSLVSMMQLVATQVLQAALSVQESPSVAGPSPQLSIPAGSEEKKQESSQEVVPGVVPPCSGYPVINIWIVGHYITHWAFVRATSTCLGSCLGLPESFSVSWVTKCDMKWEEFMPIVMARAAFHGPPKALIVQLGDNDLGLRSGKDLAVSMIKDFDKLAALFPGLTLIWSEMLVRRHWQDFPSPRGINKTRKTINRRVAEKVQLLNGQVIRHPNITYRQEDLFHNDGVHLSDLGSDVWLADLVKGIKDWLQV"

     misc_feature    <617..>1024
                     /gene="LOC114604422"
                     /note="104 kDa microneme/rhoptry antigen; Provisional;
                     Region: PTZ00449"
                     /db_xref="CDD:185628"
     misc_feature    <1571..1942
                     /gene="LOC114604422"
                     /note="or GDSL_hydrolase, is a diverse family of lipases
                     and esterases. The tertiary fold of the enzyme is
                     substantially different from that of the alpha/beta
                     hydrolase family and unique among all known hydrolases;
                     its active site closely resembles the typical...; Region:
                     SGNH_hydrolase; cd00229"
                     /db_xref="CDD:238141"
ORIGIN      

cgtttatgcctccgtcttcagaatctccatctccgtcaatgatgaatgattatcatgctgtgtcgccaacagtacttccacacatgtgttctctgtgtaaaatagaatgttcaagtatgatgggctggaatctgcacgtgggcagtattcacacttcaagaaatgtgatgagctacgccaacggtatcctgactggaatccagaagaattttctttgttacagagacatgaaggcgacaagaaggaaaaacatattccaatgccatgctctaccagttctaacccaaacacttcacagcactcaattcctggccatgcctcaagtcagactcggtcacgatctaggagccctggaccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccctgggccccacagcagaaaacggtcacgatctaggagccacagacataggtccaggtcttcagagcgacgaagctcccccagctcaagttctcaaacctcggctagccagaaaagagaactgagaaaatcaactagatctccagcatcgtctgcagaagcaggaagctccaggaaacctccagccaaatctgatgcggcagaacaaccacccaagaagtcggagcatccactgcagacaaatcctggccaccaggagccgcccaagaaggaggtcgcaatgcgggaacaaggagaccagcaacttccatccaaatctgatgtggcaaaacaaccacccaacaagtctgaccagccactactgacaaatcccggccatcaggagctgcccaagaaggaggcagcaacgcaggaacaagcagaccggcaacctccagccaaatctgatgtggcagaacaaccacccaagaagtcggagcatccactgcagacaaatctcgaccatcaggagctgcccaagatggaggcagcaacacagggacaaggagaccgccaacgtgaagatcatatgcgcttttcattgacaccatttgtagaacaaagtgtcatgcaggccctgtcgctgctgcagcctggaggcacagtgggtgctggactcacccaaggaacaagcttgcccccacttcctgctttgcagatcgaggcagcatccctatcccttgtctccatgatgcagcttgttgcaacacaggtattgcaagctgccttaagtgtgcaggaaagcccaagtgtggctggcccaagcccccagttaagtattcctgcaggaagcgaagaaaagaagcaggagagcagtcaggaagtggtgccaggagtcgttcctccttgctcaggttaccccgtgattaacatatggatcgtgggacactatatcacccactgggcctttgtgcgtgccaccagtacctgcttgggtagctgcctggggcttcctgaaagtttcagtgtttcctgggtcacaaagtgtgacatgaaatgggaggagtttatgccaatcgtgatggccagagctgcctttcatggcccccccaaagctctgattgttcaacttggagacaacgacctgggtctaaggagcggcaaggacctagccgtaagcatgattaaggactttgataagctggctgctttgttcccaggcctgaccttaatctggtctgaaatgctggtgaggcggcattggcaagatttccccagcccgcggggaatcaacaagaccaggaagactattaatcgtagggtggcagagaaggtgcagctcttgaatggacaggtgatacgacaccccaacattacttacaggcaggaggacttgtttcataatgacggcgttcacctttccgatttgggaagtgatgtttggctggctgatctcgtcaagggcattaaggattggctgcaggtgtgagggtgttggcagcgatcctttggggcttgagtggcggttaggcattgggtaagtcttgtttatgggaggggagattgtagcctccacctgcccctcctcgttaagggtatcctgttaaagggatctgggtgtgtggtgcctgtccaaagcctgggcgtgggctagggccatgccacaaccccttcagggaccctgggggtgccacgatttgatgtatatcatagggctccctctaccggtggtttattcttaggagggtccctgcagatgggcaggagtcatgatatagtcttctttcacccaatgcctaagacaaaccgctcacgtgtgtaaccaataaagttgtggcccattttatcccattgacctaaa

//