LOCUS       XM_028647725             735 bp    mRNA    linear   PLN 05-APR-2019
DEFINITION  Alternaria arborescens hypothetical protein (AA0111_g2001), partial
            mRNA.
ACCESSION   XM_028647725
VERSION     XM_028647725.1
DBLINK      BioProject: PRJNA531023
            BioSample: SAMN06205217
KEYWORDS    RefSeq.
SOURCE      Alternaria arborescens
  ORGANISM  Alternaria arborescens
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Alternaria; Alternaria sect. Alternaria.
REFERENCE   1  (bases 1 to 735)
  AUTHORS   Armitage,A.D., Cockerton,H.M., Sreenivasaprasad,S., Woodhall,J.,
            Lane,C., Harrison,R.J. and Clarkson,J.P.
  TITLE     Genomics, evolutionary history and diagnostics of the Alternaria
            alternata species group including apple and Asian pear pathotypes
  JOURNAL   bioRxivorg (2019) In press
REFERENCE   2  (bases 1 to 735)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (05-APR-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 735)
  AUTHORS   Armitage,A.D., Barbara,D.J., Woodhall,J.W., Sreenivasaprasad,S.,
            Lane,C.R., Clarkson,J.P. and Harrison,R.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-OCT-2017) Genetics, Genomics and Breeding, NIAB-East
            Malling Research, New Road, East Malling, Kent ME19 6BJ, United
            Kingdom
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_021167858).
            
            ##Genome-Annotation-Data-START##
            Annotation Date     :: AUG-2017
            Annotation Method   :: Ab initio gene prediction: Braker 1.9 and
                                   CodingQuary 2.0; Functional annotation:
                                   Swissprot (July 2016 release) and
                                   Interproscan 5.18-57.0
            Annotation Provider :: Harrison Lab NIAB-EMR
            Annotation Version  :: Release 1.01
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..735
                     /organism="Alternaria arborescens"
                     /mol_type="mRNA"
                     /strain="FERA 675"
                     /isolation_source="infected leaves"
                     /host="apple"
                     /db_xref="taxon:156630"
                     /chromosome="Unknown"
     gene            <1..>735
                     /locus_tag="AA0111_g2001"
                     /db_xref="GeneID:39617329"
     CDS             1..735
                     /locus_tag="AA0111_g2001"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_028510615.1"
                     /db_xref="GeneID:39617329"
                     /db_xref="GO:0005507|GO"
                     /db_xref="GO:0006801|GO"
                     /db_xref="GO:0016532"
                     /db_xref="GO:0030001|GO"
                     /db_xref="GO:0046872"
                     /db_xref="GO:0046872|GO"
                     /db_xref="GO:0055114"
                     /db_xref="PFAM:PF00080"
                     /db_xref="PFAM:PF00403"
                     /translation="

MTVPSFETIFAVPMTCQSCINDIEGSLQQLGGINKVTANLKDQLVSIEGTAAPSAIVEAIQATGRDAILRGSGRSDSAAVCILESHAPHVENKVRGLVRMVEVAPSMTIIDLSIRGLSPGTYHATIRESGNISDGPESTGAIWEHHKAKQEGKPCRGVFGTVQVGKGGVGSVFLDKPIHIWEMIGRSIVVAKEQDGKFDKNDPDTLVGVIARSAGVWDNDKTVCSCSGKTVWQEREEQRDRGML"

     misc_feature    1..699
                     /locus_tag="AA0111_g2001"
                     /note="copper, zinc superoxide dismutase; Region:
                     PLN02957"
                     /db_xref="CDD:215516"
ORIGIN      

atgactgttccgtcgtttgaaaccatcttcgcggtgccgatgacctgccagtcatgcatcaacgacattgaaggttctctgcagcagttgggtggtatcaacaaagtcactgccaacctcaaagatcaactggtatctatcgagggtacagcagcaccatcggcaatcgttgaagctattcaagctactggtcgtgatgcaattctaagaggatctggaagatcagacagcgccgcagtttgcattctagaatcgcatgcaccgcatgtagagaacaaggttcgagggcttgtgcgcatggtggaagtggctccaagtatgaccatcattgacctgagtatacgaggattgtcgcctggaacataccatgcaactatccgcgaatctggcaacatatccgacggacctgaatctaccggcgccatctgggaacatcacaaagccaaacaggagggcaagccgtgtcgaggcgtctttggaaccgttcaggtagggaagggtggagtcggatctgtgttcctggacaagcccatccacatctgggagatgatcggacgcagcatcgtagttgcaaaggagcaagacggcaagtttgataagaacgacccggatacgctagtgggtgtcattgcacgtagcgctggtgtttgggacaacgacaagacggtatgttcgtgttccggaaagacggtctggcaggagagagaggagcagcgcgaccgtgggatgctatga

//