GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 06:52:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_028312567             925 bp    mRNA    linear   INV 12-MAR-2019
DEFINITION  PREDICTED: Ostrinia furnacalis copper-transporting ATPase 1-like
            (LOC114358567), partial mRNA.
ACCESSION   XM_028312567
VERSION     XM_028312567.1
DBLINK      BioProject: PRJNA525080
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Ostrinia furnacalis (Asian corn borer)
  ORGANISM  Ostrinia furnacalis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata;
            Ditrysia; Pyraloidea; Crambidae; Pyraustinae; Ostrinia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021134265.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ostrinia furnacalis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 15% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..925
                     /organism="Ostrinia furnacalis"
                     /mol_type="mRNA"
                     /isolate="ACB-3"
                     /db_xref="taxon:93504"
                     /chromosome="Unknown"
                     /sex="female"
                     /dev_stage="Pupae"
                     /country="China: Beijing"
                     /collection_date="2015-04-09"
     gene            <1..>925
                     /gene="LOC114358567"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 84% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:114358567"
     CDS             <1..>925
                     /gene="LOC114358567"
                     /codon_start=2
                     /product="copper-transporting ATPase 1-like"
                     /protein_id="XP_028168368.1"
                     /db_xref="GeneID:114358567"
                     /translation="
SLLPKPIPTDLLIDMGTSSEESEVVLHVTGMTCQSCVNTIEVVSINETNSQNNSQEGSGDSAKPPTPVKSKTHANGTASPMADRQTEPVELSCCTLEVKGMTCASCVAAIEKSCSKLYGVHSIVIALLAAKAEVKYEPAKISAADVARSVTELGFPAEVRADCDGSGQKEMQVLIKGMTCASCVNKIEKTVLKLPGVVSCAVALTTSKGKIKYMAEQIGPRSICDAINSLGFEASVVGPRDRGTTHYLEHKEEIKRWRTAFLISLLFGGPCMVSMAYFMAHMEHGHIAVLPGLSLENLIMFLLATPVQ"
     misc_feature    284..475
                     /gene="LOC114358567"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(302..310,317..319)
                     /gene="LOC114358567"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    515..>925
                     /gene="LOC114358567"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
     misc_feature    524..712
                     /gene="LOC114358567"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Eh;
                     NF033794"
                     /db_xref="CDD:411374"
ORIGIN      
aagtctcctaccaaagccaatacccaccgatcttctgatagacatggggacgtcaagcgaagagagcgaagtggtgctacacgtcaccggcatgacttgccagtcgtgcgtcaacaccatcgaagtcgtcagcatcaatgaaacaaattctcagaacaactcccaagaaggatctggtgatagtgccaaaccaccaacacctgttaaaagcaaaacacacgcaaacggcacagcgtcgcccatggcagacagacagacagagccagttgaactgtcttgctgtacgctggaagtgaaaggcatgacgtgcgcctcctgcgtcgctgctatagagaagagctgttccaagctgtatggcgtccactcaatagtaatagcccttctagcagctaaagcagaagtcaagtacgagccggcaaagatatcggcggcagacgtggctcggtccgtcaccgaacttggattcccggctgaagtgcgagcggactgcgacggcagcgggcagaaggagatgcaggttctgatcaaaggcatgacgtgcgcgtcgtgtgtcaacaaaatagagaagactgtgctcaaattgcccggcgtggtttcttgtgcagtcgcgctcacaacttccaagggcaaaataaaatacatggcggagcagataggcccccggagtatatgcgacgcaatcaactccctcggcttcgaggcttcggtcgtcgggcctagggataggggcaccacacactacttggagcacaaagaagaaataaaaagatggcggacggcgttcctaatatccctactattcggcgggccctgcatggtgtccatggcttacttcatggcgcacatggagcacgggcacatcgcggtgctgccgggcctcagtctggagaacctcatcatgttcctgctcgccacgcctgtgcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]