LOCUS       XM_027557321            6427 bp    mRNA    linear   MAM 25-DEC-2018
DEFINITION  PREDICTED: Bos indicus x Bos taurus ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_027557321
VERSION     XM_027557321.1
DBLINK      BioProject: PRJNA508959
KEYWORDS    RefSeq; corrected model.
SOURCE      Bos indicus x Bos taurus (hybrid cattle)
  ORGANISM  Bos indicus x Bos taurus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Bovinae; Bos.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_040087.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bos indicus x Bos taurus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            frameshifts :: corrected 1 indel
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-237               PUFS02000012.1     21189968-21190204   c
            238-1408            PUFS02000012.1     21175216-21176386   c
            1409-1666           PUFS02000012.1     21171097-21171354   c
            1667-1689           PUFS02000012.1     21169120-21169142   c
            1690-1830           PUFS02000012.1     21168978-21169118   c
            1831-1992           PUFS02000012.1     21166885-21167046   c
            1993-2069           PUFS02000012.1     21164330-21164406   c
            2070-2241           PUFS02000012.1     21163433-21163604   c
            2242-2475           PUFS02000012.1     21162127-21162360   c
            2476-2567           PUFS02000012.1     21161326-21161417   c
            2568-2695           PUFS02000012.1     21158024-21158151   c
            2696-2850           PUFS02000012.1     21157768-21157922   c
            2851-2985           PUFS02000012.1     21157414-21157548   c
            2986-3180           PUFS02000012.1     21153591-21153785   c
            3181-3363           PUFS02000012.1     21151569-21151751   c
            3364-3532           PUFS02000012.1     21149500-21149668   c
            3533-3676           PUFS02000012.1     21147736-21147879   c
            3677-3819           PUFS02000012.1     21146848-21146990   c
            3820-4023           PUFS02000012.1     21145278-21145481   c
            4024-4141           PUFS02000012.1     21145065-21145182   c
            4142-4244           PUFS02000012.1     21143657-21143759   c
            4245-6427           PUFS02000012.1     21140727-21142909   c
FEATURES             Location/Qualifiers
     source          1..6427
                     /organism="Bos indicus x Bos taurus"
                     /mol_type="mRNA"
                     /db_xref="taxon:30522"
                     /chromosome="12"
                     /sex="male"
                     /tissue_type="lung"
                     /dev_stage="fetus"
                     /collected_by="Stefan Hiendleder"
                     /breed="Angus x Brahman F1 hybrid"
     gene            1..6427
                     /gene="ATP7B"
                     /note="The sequence of the model RefSeq transcript was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: deleted 1 base in 1 codon;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 16 ESTs, 3 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 19 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:113902267"
     CDS             1..4518
                     /gene="ATP7B"
                     /note="The sequence of the model RefSeq protein was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: deleted 1 base in 1 codon"
                     /codon_start=1
                     /product="LOW QUALITY PROTEIN: copper-transporting ATPase
                     2"
                     /protein_id="XP_027413122.1"
                     /db_xref="GeneID:113902267"
                     /translation="

MERAGDQTPGNPEPSSLATLGDPQVTLLSVHKQWSFKRSPGTGGSSRPVISEEECPPPSEEGEFSQKVLNGSEEISSKQILSKLSQPAMKQSFAFDNNGYEDDLDGVRPSHTATGTINIVGMTCQSCVKSIEGRVSSLKGIVSIKVSLEQGSAEVRYVPSVVSLVQICHQIEDMGFQASVAEGKATSWPSRVSPASEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVLRVRVSLSNQEAVITYQPYLIQPQDLRDHITDMGFEAVIKNKVAPVSLGPIDVRRLQSTLSAAPPAPVNQNDNNSETPGGQGIPLHLRVDGMHCKSCVLNIEDNIGRLPGVQSIHVSLESRTAQVQHDPSLVSPGALQRAIEALPPGNFKVSLPNGVEGSGPDSRSPPASSAPCTVMLAIAGMTCKSCVQSIEGLISQRAGVHQISVFLAEGTAVVLYDPSRTHPEELRAAVEDMGFEASILAENCSSNHIGNHSSGSAVGHVAAGTPVPVQGGTPQPGELHTNHIPRQSPKSLPASTTVAPKKCFLQISGMTCASCVSNIERNLQKEPGILSVLVALMAGKAEVKYNPEAIQPLEIAKLIQDLGFEAAVMEDYTGSDGDLELMITGMTCASCVHNIESKLRRTEGITYASVALATSKAHVKFDPEIIGPRDIVKLIEEIGFRASLAQRIPNAHHLDHKVEIKQWKNSFLCSLVFGIPVMGLMIYMLIPSHEPQSTVLDHNVIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHGMANMDVLIVLATSVAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVVKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSMVIAGSMNAHGSVLVTATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTVTLVVWIGIGFTDFGVVQKYFPVPSKGISQAEVVLRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVSRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETLGCCTDFQAVPGCGISCKVSSVESILAQGERLQGPLTTHLNRVGSNPTETDAATQTFSVLIGNREWMRRNGLTVTSDVRDAMTDHEMKGQTAILVAIDGVLCGMIAIADSVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNQGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSRRTVWRIRLNLVLALIYNLIGIPVAAGVFIPIGVVLQPWMGSAAMAASSVSVVLSSLQLKCYRKPDLARYEAQAHGSMKPLSASQVSVRVGMDDRRRDSPRASAWDQVSYVSQVSLSPLKSDKLSRHSGAADDRGDKWSLLLNDRDEEQGI"

     misc_feature    346..537
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(364..372,379..381)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    601..789
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(619..627,634..636)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    937..1110
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(952..960,967..969)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1207..1398
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1225..1233,1240..1242)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1597..1785
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1612..1620,1627..1629)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1822..2013
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1840..1848,1855..1857)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2077..4182
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3067..3069,3073..3075,4111..4113)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3199..3207,3409..3411,3562..3570,3658..3660,
                     3778..3786,3844..3846,3853..3855,3862..3864,3919..3921,
                     3928..3930)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

atggagagagctggggaccagacgcccgggaaccccgagccatcctccctggcgactctgggtgacccacaggtgaccctgctatctgtccacaaacagtggtccttcaagaggagccctgggaccgggggctccagcaggcccgtgatttcagaggaggaatgccctcccccgtcagaggaaggagaattttcacagaaggttttgaatggatcggaagagatcagttccaagcagatcctgtctaagctctcccagccagcgatgaagcagagctttgcctttgacaacaatggctacgaggatgacctggatggcgtgcgcccctcccacacggccactggcaccatcaacatcgtgggcatgacctgccagtcgtgtgtcaagtccatcgagggcagggtctccagtttgaaaggcattgtgagcattaaggtttccctggagcagggcagcgctgaggtgaggtacgtgccctcagtggtaagcctggtgcagatttgccatcagattgaagacatgggcttccaggccagtgtggctgagggaaaggccacctcctggccctccagggtctcacctgcctcagaggccatggtcaaacttcgggtggagggcatgacctgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcagggcgtcctgagggtccgtgtctcgctcagcaaccaggaggcagtcatcacttaccagccttaccttatccaaccccaagacctcagggaccacataactgacatgggatttgaagccgtcatcaagaacaaggtggcccccgtgagcctgggacccatagacgtcaggcggctccagagcaccctctcagcagcccctccggctcccgttaatcagaatgacaataactctgagaccccggggggccaggggatccccctgcacctgagagtggatggaatgcactgtaagtcttgtgtcctgaacattgaagacaatatcggccggctccccggggttcagagtattcacgtgtccctggagagcaggactgcccaagtccagcatgacccttctctcgtctccccaggggccctgcagagagccattgaggccctgcctcctgggaactttaaagtctctcttcccaatggggtggaagggagtgggccagactccaggagccccccggcgtccagtgcgccctgtaccgtgatgctggccatcgccggcatgacctgcaagtcttgcgtccagtccatcgaaggcctgatctcccagagggcgggtgtgcaccagatctcagtctttttggccgaagggactgcagtggttctctacgatccatctcgaactcacccagaagaactgcgagctgcggtggaggacatgggattcgaggcctccatcctggctgaaaactgttccagcaaccacattggcaaccacagctctgggagtgccgtggggcacgtggcggctggcacacctgtgcctgtgcagggagggactccccagccaggggagctccatactaaccacatcccccgccagtcgcccaagtccctgccggcctccaccacggtggccccaaagaagtgcttcctacagatctcaggcatgacctgtgcatcctgtgtgtccaacatagagaggaacctgcagaaagaacctgggatcctgtccgtgctggttgccctgatggcgggaaaggcagaggtgaagtacaacccggaagccatccagcccctggagatagcaaagctcatccaggacctgggctttgaggcagcagtgatggaagactacacgggctcggatggtgacctcgagctgatgatcacggggatgacctgcgcctcctgtgttcacaacatagaatccaaactcaggaggacagaaggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaattattggtccgcgggatattgtcaaactcatcgaggaaattggctttcgtgcctccctggcccagaggatccccaatgctcatcacttggaccacaaggtggaaataaagcagtggaagaactctttcctgtgcagcctggtgtttggcatccccgtcatgggtttaatgatctatatgttgatacccagccatgagccccagtcgacggtcctggaccacaacgtcatcccaggactgtccatcctgaatctcatcttctttatcttgtgcacctttgtccagttcctcggcggctggtacttctatgtccaggcctacaaatctctgagacacgggatggccaacatggacgtgctcatcgtgctggccacgagcgtcgcctatgtctactccctcgtcatcctggtggtggccgtggccgagaaggccgagaggagccccgtgaccttctttgacacgccccccatgctcttcgtcttcattgccctggggcggtggctggaacacgtggtgaagagcaaaacctcagaagcgcttgccaaactcatgtctctgcaagccacggaagccaccgtcgtgacccttggtgaagacaacgtgatcatcagggaggagcaggtgcccatggagctggtgcaacgaggtgacatcatcaaggtggtccccgggggcaagtttcccgtggacgggaaagtcctagaaggcaacaccatggccgacgagtccctcatcacaggagaggccatgcctgtcaccaagaagcccggaagcatggtaattgccgggtccatgaacgcccatggctctgtgctcgtcactgccacccacgtgggcaatgatacgaccttggcccagattgtgaagctagtggaagaggcccagatgtccaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactgtgacgttggtggtatggattggtatcggttttaccgattttggtgttgttcagaaatactttcctgtccccagcaagggtatctcccaggcagaggtggtcctgcggttcgcgttccagacgtccatcacggtgctctgcatcgcctgcccctgctcgctgggcctggccacacccacggccgtcatggtgggcaccggggtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagaccgtgatgttcgacaaaaccggcaccattacccacggggtccccaaagtctcacgggtcctcctgctcgtggacgtggccacgctgcccctgcggaaggtgctcgctgtggtggggactgcagaggccagcagcgagcaccccctgggcgtggcagtcaccagatactgtaaagaggaacttggcacggagaccctggggtgctgcacggactttcaggcagtgcccggctgtggaatcagctgcaaagtcagcagcgtggagagcatcctcgcccaaggcgagcgcctgcaaggcccactgaccactcacctgaacagagtcggcagcaaccccacagaaacagacgcggccacgcagaccttctctgtgctgatcggaaaccgggaatggatgaggcgcaatggcctgaccgttaccagcgacgtccgcgacgccatgaccgaccacgagatgaagggccagacagccatcctggtggccatcgatggtgtgctgtgcggtatgatcgccatcgcggactcggtcaagcaggaggccgccctggccgtgcacacgctgaagagcatgggcgtggacgtggtgctcatcaccggggacaaccgcaagacagccagggccatcgccacccaggtcggcatcaacaaagtctttgcggaggtgctgccttctcacaaggtggccaaggtccaggagctgcagaaccaggggaagagagtggccatggtgggcgacggtgtgaacgactccccagccctggcacaggctgacgtgggcattgccattggcacgggcactgacgtggccatcgaggcggccgacgtcgtcctcatcaggaatgacctgctggatgtggtggccagcattcacctctccaggaggaccgtctggagaatacggctcaacctggtgctggcgctgatctacaacctgatcgggatccccgtcgcggcaggtgtcttcatacccattggtgttgtgctgcagccgtggatgggctcggcggccatggcggcctcctctgtgtctgtggtcctctcgtcactgcagctcaagtgctacaggaagccggacctggcgcggtacgaggcgcaggcgcacggcagcatgaagcctctgagcgcgtcccaggtcagcgtgcgcgtcggcatggacgaccgccggcgtgactccccgcgggcctcggcctgggaccaggtcagctacgtcagccaggtgtccctgtcccccctcaagtccgacaagctgtcccggcacagtggcgcggccgatgacaggggcgacaagtggtctctgctcctgaatgaccgggacgaggagcagggcatctgaaagccgcccccgtggctgaggctcccagccagcagcggcagcagcaggcggccgagcccctccaggcctgggcgaatattctggatcaccctttccctgcacccagggggctcgattccccgggtcccacgggctcgggagaaggcgtgcttgctcacgcttgtgggctcatcgcacaccttgctgtggcctcaagaagaggagggacaagccctcctcgcatcccctgccttagcacttgtgacacgaccagtctcatcgggtccaacatcttcgctgtgcacctccacagagctcataaaaacttaggggtctggctctttctgacagcacccccgtgcatcgcgaacccgagaccaccgtgtacctcaagcgcccccttgttttctgctggggccccctcttcctcctctgcccttgatggtgggggtgtgacaccccatcatctgagggcagggctgatatcatcacttcccctctgctgctctccaaggggctcctgtgctcctgcctgaacccctgcccacacgaccaccagagagccacgcttctcctcggagaccagaggtcttggttgcccgcgagctgcttcgcgctagagtcccggcttctcacgctcaatccagtgtggttgctgactgttgctgcctagctgggctgagggtctgagagcctgaggcttgagaaatttggcttcctgtggggtcctggggaaggcacgtggctcaagattctgcttgcctggtttcaagggtttcagttgcatggcctgtggtgtgacagtcgcctcacagggtctggtatggggttcaggtctgtgctccccagagctgtgcagcccaagtaagaggacaccccagccctccacaagcttcgactcctgcacatggagctggtgccttaggaagggggtgcccaccactcccaagggaactgtttctaacttcagtgacctttatggttgcaggataatcagagcaacagcaatgggcccatggcagacttcgagcttggtggtgattggcagagcctgtgggagtctgcaaatactagccaaatcttagactgagtagagtctgttctcagtttcaagggggaagcccttatcacacacactttagttagttattgtcagttattttttagggggatataagcactttttatcgcttacctctaatattcacaatgaactagcgaagtagatagaatattgtccacatttcgcaggcgggaaacaggctcagagaggctagaaatcccaccaaggatcacacagccagtgtgcatgccagagcaggaatctgaattcacatccacgggccctgaagtcttttctttaatttggctctactgtcaatattttgtttgataagaagcaacaaggaaaagtcccttgttcctggaagaacaaagctgccaggtgatgtattcactgaactggcttgaaatgtgactgcgaggtcatgtcacattgccttcagatagctccttcccatttgcatataattgagtctgtgcagcgtcttatcctttaaaatccgtgtgcagggtagaggtgtggttttgcttccagtcttccttccccagccctgtcctgcttatgttctcagttgtgtcctttctctgttcccagctgctgctcagggaatgtttcctgtttccctccaagaagctaatcatctaaagaatccaattgtaatcaatttttcaaaaagcttttaggaccctgaatgttatgtgtatagggacatggagatatttatataattgtacagaagataaccttttagatgttcaaaaagtgtcaggaatgttttgttgttcgtttttttggtcaggaaagaagaattcctatttcaaaaacattccatgctatatttagaataaaatttcattttttgtattc

//