LOCUS       XM_026653648            5701 bp    mRNA    linear   VRT 15-JUL-2019
DEFINITION  PREDICTED: Terrapene carolina triunguis copper-transporting ATPase
            2-like (LOC112114385), transcript variant X2, mRNA.
ACCESSION   XM_026653648
VERSION     XM_026653648.1
DBLINK      BioProject: PRJNA435426
KEYWORDS    RefSeq.
SOURCE      Terrapene carolina triunguis (Three-toed box turtle)
  ORGANISM  Terrapene carolina triunguis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Emydidae; Terrapene.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020664493.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Terrapene carolina triunguis
                                           Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5701
                     /organism="Terrapene carolina triunguis"
                     /mol_type="mRNA"
                     /isolate="2854851"
                     /isolation_source="Kennedy Woods, Forest Park"
                     /sub_species="triunguis"
                     /db_xref="taxon:2587831"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /country="USA: St. Louis, MO"
     gene            1..5701
                     /gene="LOC112114385"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 23 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:112114385"
     CDS             110..4738
                     /gene="LOC112114385"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like isoform X2"
                     /protein_id="XP_026509433.1"
                     /db_xref="GeneID:112114385"
                     /translation="

MERESDGDLKRDQSTLATLNNKNVTLVTFHKRQSSNAVPALLIVSEPSKSGSPGKAGDCSQKEEKVSQSYNVGASEVNSMHALSKSSSPASCVWEPVMNQNFAFDNTGYEGSAENMPSLLPQTSTVTVNILGMTCQSCVQSIEGRISKVKGIVSIKISLEQSNAVIKYIQSEIGLQEICQEIGEMGFDANIAEGRTTASSVRSTSLGEALLKLRVEGMTCQSCVNIIEGKIGKLHGVLRIKVSLSNQEAVIAYQPYIIQPEDLKNHIDNMGYESTIKSKLAPLKLGMIDLERLQTTSTKKTPASLNNSNVEPVVGKMNSTTTMTLGVEGMHCKSCVKNIEGNISGLPGVHSIKVSLEHKNAVMQFNPNVITPVSLQQAIEALPPGNFKVSLPNGVEANNRELLSKAAFSSPQFRSTSSGDQLTSTSVLSIDGMTCGSCVQSIEGTMSQRKGVQHISVSLAERTGTIHYNSAVTNSEELRGAIEDMGFDASILTDTTTWKYMDQPLFRDAAIQPNAWESASQRTENVSESSHQGYMSDVQSKNSYLSSPKPPSVETTEKCFMQITGMTCASCVSNIERNLQKEDGIVSVLVALMAGKAEIKYKPESIQPLEIVQLIQNLGFNATVIEDHTATDGNAELIITGMTCASCVHNIESKLTRTNGIFYASVALATSKAHIQFDPEIIGPRDIIQIIEGIGFHASLAKRDPNAHNLDHKKEIKQWRKSFLCSLVFGIPVLILMIYMLIPDGQQHGTMVLEQNLIPGLSILNLLFFVLCTLVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYIYSCVILVVAIAEKAEESPVTFFDTPPMLFVFISLGRWLEHIAKSKTSEALAKLMSLQATEATIVTLGPDHSVIREDQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLLVWITIGFINFDVVQKYFPHQNKHLSKAEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVVRMLLLGDMAKLSLKKVLAIVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVRSVEAVLGQSEQSVNEQNAYLSSVSTISLGHSSSIMVSESDGAAAPLTYSVLIGNREWMRRNGLLISSDVNDAMTGHEMKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLQNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALAGADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPGTERYEAKAQGHMKPLTPSQISVHIGMDNRRRDSPRPTAWDQISQVSLSSLTSNKLPGHGGFREEEGGKWSLLANDRDEEQYI"

     misc_feature    488..676
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(506..514,521..523)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    743..934
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(761..769,776..778)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1079..1255
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1097..1105,1112..1114)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1388..1579
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1406..1414,1421..1423)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1790..1978
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1805..1813,1820..1822)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2015..2206
                     /gene="LOC112114385"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2033..2041,2048..2050)
                     /gene="LOC112114385"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2270..4411
                     /gene="LOC112114385"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3263..3265,3269..3271,4340..4342)
                     /gene="LOC112114385"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3395..3403,3605..3607,3791..3799,3887..3889,
                     4007..4015,4073..4075,4082..4084,4091..4093,4148..4150,
                     4157..4159)
                     /gene="LOC112114385"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

agaacttttgttctggatattgctgggagaagtttttctgataatttatggaataacatctcttaaaaattcccatttggcattacaatatttgaagcctggaaagataatggagagggaatcagatggtgatttgaaaagggaccagtccaccctggctactttaaacaacaaaaatgtaaccctggtgacttttcataagcggcaatcatctaatgctgtgcctgcactactgattgtcagcgaaccctccaagtcaggctctcctggaaaagcaggcgactgctctcagaaagaagagaaagtttcacagagttacaatgtgggagcatcagaagtcaacagcatgcatgctttgtctaagtctagctcccctgctagttgtgtatgggaaccagtcatgaaccagaattttgcctttgacaacactggctacgaggggagcgctgaaaatatgccctctctgcttcctcaaacgagcaccgtcacagtcaatattttgggtatgacttgccagtcttgtgtgcagtcgatagagggcagaatttccaaggtgaagggcattgtgagcatcaagatctctcttgagcagagcaatgctgtaataaaatatatacagtcagaaataggtctccaagagatttgccaggaaattggagaaatgggctttgatgccaacattgcagaaggaagaactacagcatcatctgtaagatcgacgtccttgggagaagcactattgaagctgcgggtagaaggtatgacatgccaatcttgtgtcaacatcatcgaaggaaagattggaaaactacatggcgtgctgagaatcaaagtctccctcagtaaccaagaagcagtcattgcttaccagccttacatcattcaacctgaagacctcaaaaaccacatagataacatggggtatgaaagcacgattaagagcaagctagccccattaaagcttggtatgattgatctagaacgcttgcagactacaagcacaaagaaaactccagccagcctgaacaatagcaatgtggagccagtggtgggcaaaatgaatagtacaacaactatgacactgggagtagaagggatgcactgcaagtcttgcgtcaaaaacatcgaaggaaatatatcaggtcttccaggcgtacacagtattaaagtgtcattggaacataaaaatgctgttatgcaatttaacccaaacgtaattaccccagtatctttgcaacaagccattgaggcccttccacctggtaactttaaagtatccctccctaatggagtggaagcaaataacagagagcttttatcaaaggcagcattttcatcacctcagtttcgtagcacgtcctctggggatcagctgacaagcacatctgtacttagtattgatggaatgacctgtggatcctgtgtacagtccatagaaggcacaatgtcccaaaggaaaggggtacaacatatatcagtttcgttagctgaaaggactggaaccatacactacaattcagctgtaactaattcagaagagctaagaggtgctatagaagacatgggatttgatgcttccattctcacagataccaccacttggaaatatatggatcaacctcttttcagggacgctgcgattcagcctaatgcttgggagtcagcttcccagagaacagaaaatgtttctgaatcgtctcatcaaggctacatgtctgatgtccagtcaaagaattcttacctcagtagtccaaagccacccagtgtagagacaacagaaaagtgctttatgcagatcacaggcatgacctgcgcatcatgtgtgtcaaacattgaaagaaatctgcaaaaagaagacggcatcgtttcagtgctagtagcactgatggcaggaaaagcggagataaaatacaagccagagagcattcagcctcttgaaatagtacagctgatccaaaacttgggcttcaatgctacagtcatagaagatcatactgctacagatggcaatgcagagcttattattacggggatgacttgtgcttcatgtgttcacaatattgaatccaaactaaccagaactaatggcatcttctatgcctcggtagcgcttgctaccagcaaagctcacatccagtttgatcctgaaatcattggacctcgagatattatacaaattattgagggaattggttttcatgcttccttggccaagagagaccctaatgctcataacttggatcacaaaaaggaaataaaacaatggaggaaatctttcttgtgcagcctagtgtttggaatccccgtcttaatcttaatgatttatatgctaatacctgatggccaacagcacggcactatggtgctggaacaaaatctaattcctggattatctattttaaatcttctcttctttgtcttgtgcactttggttcagttcctcggtggatggtacttttatgtccaagcctacaaatcactgaagcacaaaacagccaatatggatgtactgattgtgctggccacaactattgcttatatatactcttgtgtgatcttggtggtggctatagccgaaaaggcagaggaaagccccgtcacgttctttgacacaccacccatgttattcgtattcatttctcttgggagatggttggaacacatagcaaagagtaaaacatcagaagcacttgctaaactaatgtctctccaagctactgaagctaccatagtgactcttggacctgaccactccgtcatcagggaggatcaggtggctgttgaactggttcagcggggtgacattgtaaaagttgtccctggtgggaagttcccagttgatggaaaagtcattgaaggcagctctatggcagatgaatctctcattactggggaagccatgccagtcactaaaaaacctgggagcacagtgattgcaggttctataaatgcacatggctcagttcttgttaatgcaactcacgttgggtctgacaccaccctggcacaaattgtgaaattggtagaagaagctcagatgtcaaaggcacccatccagcaattggctgataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgctagtgtggatcacaattggctttataaactttgatgttgttcagaaatactttcctcatcagaacaaacacctctcaaaagctgaagtaatactgaggtttgcatttcaaacctcaatcactgtgctgtgcattgcatgcccctgttccttgggcttggctactccaacagctgtgatggtgggcacaggcgttgctgcccagaatggtattctcatcaaaggtggaaaacctctggaaatggcccacaagataaagactgtgatgtttgataaaaccgggaccatcacctgtggcgttcctaaagtcgtgaggatgctcttgctaggggacatggctaagctgtctctaaagaaggtacttgcaattgtcggcactgcagaagccagcagtgagcatcccttaggaatggctgtcactaaatactgtaaagaggaacttggcacggagagcctgggatactgcacagattttcaggcagtcccaggctgtggaatcagctgtaaagtccgcagtgtggaagctgtactgggccagagtgagcagagtgtgaacgagcagaatgcttacctgagcagtgtcagcacgatttcgctgggacacagttcatcgatcatggtctctgaatctgatggtgcagcagcccctctgacatactcagtgctgattggaaatcgtgaatggatgagacggaacggcttgcttatatccagtgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagccatattggtggctatagatggtgcgttgtgtggaatgatcgcgatagcagatactgtcaaacaggaggcagcgcttgctgtgcacaccctgcaaaatatgggaatagacgtggtgctaataacaggggacaacagaaaaactgcaaaagcaattgctactcaggttggcatcaaaaaggtctttgctgaggttctgccctctcacaaagttgcgaaggttcaggaactccagaatgaagggaagaaggttgccatggttggagatggagtcaacgattccccggcattggctggagcggacattggcattgctattggaacaggcacagatgttgccattgaagctgcagacgttgttcttattcgaaatgacttactggatgtggtggctagtattcatctatcaaagaggacagtaagaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacctatagcggcaggggtgttcatgcccattggaattgtgctgcagccctggatggggtcagctgcaatggcagcttcttcagtatctgtggtgctatcttccctgcaactgaaatgctacaagaagccaggaactgaaaggtatgaagcaaaagctcaaggccacatgaagccactgacaccttcccaaatcagtgttcacattgggatggacaacaggagacgggattcacccaggccaactgcctgggatcagattagtcaagtgtctctctcttctctgacttcaaacaagctccctggacatggcggttttagagaggaagaaggtggcaagtggtcactgctcgctaatgacagagatgaagaacagtacatttaaatgctgcatcccatcgctgaacatgaagtcactgagattcttcaccattggcagtgatgaccaagagccccacataagtagaaatggagccctgatgttccagtttgcaaagcagctcagaaattcagcattagattgtgtgaattatgatttgtcagttcacaaataattcccaggcattgaaaaagcttgaggccctacaatgaattatgccctttacttcttgcacagtgtgaagttggagtccacaaagcctaacatgacccctacattgtggatcaattactgagaatcaaaatcacaggctgtccagtcttattgactctcttgtgcttctttatggaacttctgtgaaaagattttaaattaaatctgccaaattcattttctaggtcaaagtgaaaaccaatacaccagacatcaaatagctctatatttaaggatcatatttttatatagaatcaaatctagtcatctcaacatgggaaaattttatatttagggctcagacaacatgtgcgtgcttgattagcacaaaaatatattaattgtatattttgctgtgcataaaacttgtaaaattctgtttcaaagatgatcacgtatcttataacatcactaattttattttatgaaacgtctcaatttgccaaacttgcttgctggttttccagttttctcctgcgtgttcttcagagccctttcttcccagtagagttccacctttagacatttgttatgtcttcagattttcccgtatgggatgagatcctgcaaggcgctggggaccctgcaattcctgttgaaatccacaacgtttgagctcctttcagtgttttactggttcaggatagctcaccattttgtagaatcttttgacgctcctgataactgcagcattcagctgtttctttgatgtgcagagtggcgtaaatgtgccagtgtaagccgtcctggtggctc

//