GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-14 01:01:13, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_026126340             573 bp    mRNA    linear   PLN 31-JAN-2025
DEFINITION  PREDICTED: Glycine max uncharacterized protein (LOC112999920),
            mRNA.
ACCESSION   XM_026126340
VERSION     XM_026126340.1
DBLINK      BioProject: PRJNA48389
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Glycine max (soybean)
  ORGANISM  Glycine max
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
            Phaseoleae; Glycine; Glycine subgen. Soja.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_038253.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000004515.6-RS_2025_01
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 01/28/2025
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..573
                     /organism="Glycine max"
                     /mol_type="mRNA"
                     /cultivar="Williams 82"
                     /db_xref="taxon:3847"
                     /chromosome="17"
                     /tissue_type="callus"
     gene            1..573
                     /gene="LOC112999920"
                     /note="uncharacterized LOC112999920; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     Protein"
                     /db_xref="GeneID:112999920"
     CDS             1..573
                     /gene="LOC112999920"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_025982125.1"
                     /db_xref="GeneID:112999920"
                     /translation="
MDPIKYILEKLALIGWIAWWQVLPSEFDIVYVTQKAIKGSALADYLAQQPINDYQPMHPEFLDEVIMTFFKGEVEDKDRDKWIMLGFECTNNIAEYKACALGIQATIHFKVKLLKVYIRKLIGFFDDISFHHIPREENQMANALATLASMFQLTSHRDLPYIKFRCCGKPTHCCLIEEEQDGKPWYFDIK"
     misc_feature    <253..447
                     /gene="LOC112999920"
                     /note="Ribonuclease H-like superfamily, including RNase H,
                     HI, HII, HIII, and RNase-like domain IV of spliceosomal
                     protein Prp8; Region: RNase_H_like; cl14782"
                     /db_xref="CDD:449355"
ORIGIN      
atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggcaagcctacacattgttgcttgatagaagaagagcaagatggtaaaccttggtacttcgatatcaaatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]