ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-17 15:01:31, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_026126340 573 bp mRNA linear PLN 31-JAN-2025
DEFINITION PREDICTED: Glycine max uncharacterized protein (LOC112999920),
mRNA.
ACCESSION XM_026126340
VERSION XM_026126340.1
DBLINK BioProject: PRJNA48389
KEYWORDS RefSeq; includes ab initio.
SOURCE Glycine max (soybean)
ORGANISM Glycine max
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
Phaseoleae; Glycine; Glycine subgen. Soja.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_038253.2) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000004515.6-RS_2025_01
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.3
Annotation Method :: Best-placed RefSeq; Gnomon;
cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 01/28/2025
##Genome-Annotation-Data-END##
##RefSeq-Attributes-START##
ab initio :: 100% of CDS bases
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..573
/organism="Glycine max"
/mol_type="mRNA"
/cultivar="Williams 82"
/db_xref="taxon:3847"
/chromosome="17"
/tissue_type="callus"
gene 1..573
/gene="LOC112999920"
/note="uncharacterized LOC112999920; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 1
Protein"
/db_xref="GeneID:112999920"
CDS 1..573
/gene="LOC112999920"
/codon_start=1
/product="uncharacterized protein"
/protein_id="XP_025982125.1"
/db_xref="GeneID:112999920"
/translation="
MDPIKYILEKLALIGWIAWWQVLPSEFDIVYVTQKAIKGSALADYLAQQPINDYQPMHPEFLDEVIMTFFKGEVEDKDRDKWIMLGFECTNNIAEYKACALGIQATIHFKVKLLKVYIRKLIGFFDDISFHHIPREENQMANALATLASMFQLTSHRDLPYIKFRCCGKPTHCCLIEEEQDGKPWYFDIK"
misc_feature <253..447
/gene="LOC112999920"
/note="Ribonuclease H-like superfamily, including RNase H,
HI, HII, HIII, and RNase-like domain IV of spliceosomal
protein Prp8; Region: RNase_H_like; cl14782"
/db_xref="CDD:449355"
ORIGIN
atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggcaagcctacacattgttgcttgatagaagaagagcaagatggtaaaccttggtacttcgatatcaaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]