LOCUS       XM_025760381            3243 bp    mRNA    linear   PLN 24-MAY-2019
DEFINITION  PREDICTED: Arachis hypogaea protein argonaute PNH1 (LOC112708204),
            transcript variant X1, mRNA.
ACCESSION   XM_025760381
VERSION     XM_025760381.2
DBLINK      BioProject: PRJNA476953
KEYWORDS    RefSeq.
SOURCE      Arachis hypogaea (peanut)
  ORGANISM  Arachis hypogaea
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; dalbergioids sensu lato; Dalbergieae;
            Pterocarpus clade; Arachis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_037618.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 24, 2019 this sequence version replaced XM_025760381.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Arachis hypogaea Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3243
                     /organism="Arachis hypogaea"
                     /mol_type="mRNA"
                     /cultivar="Tifrunner"
                     /db_xref="taxon:3818"
                     /chromosome="Arahy.01"
                     /tissue_type="etiolated young seedling"
                     /dev_stage="seedling"
                     /country="USA: Georgia"
     gene            1..3243
                     /gene="LOC112708204"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, 10 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 73 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:112708204"
     CDS             637..2958
                     /gene="LOC112708204"
                     /codon_start=1
                     /product="protein argonaute PNH1"
                     /protein_id="XP_025616166.1"
                     /db_xref="GeneID:112708204"
                     /translation="

MLPFTYKEFTILLTEDDESIGTTREREFKVVIKFAARVSMHQLRELLSGKQVDTPQEALTVIDIVLRELAAQSYVSIGRFLYSPDFRKPQQLGGGLESWRGFYQSIRPTQMGLSLNIDMSSMAFIEPLPVIDFVAQILGKDVHSKPLSDADRVKIKKALRGVKVEVTHRGSFRRKYRISGLTSQPTRELNFPLDEKMNMKSVVDYFQEMYGYTIKYPHLPCLQVGSQKKVNYLPMEACKIVGGQRYTKGLNEKQITSLLKVSCQRPREQETDILQTIQENDYEYNPYAKEFGISVDSKLTSVDARVLPAPWLKYHDTGREKEYLPQVGQWNMMNKKVINGSTVRYWACINFSRSVQESTARGFCQQLVQMCQISGMEFSQDPVIPVYSAKPDLVKKALKYVHSASLENLGGKELELLIAILPDNNGSLYGDLKRICETDLGLISQCCLTKHVFKINRQYLANVALKINVKMGGRNTVLLDALSWRIPLVSDIPTIIFGADVTHPESGEDSCPSIAAVVASQDWPEVTKYAGLVCAQPHREELIQDLFKCWKDPHHGVVYGGMIRELLLSFKKATGQKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPSYQPPVTFVVVQKRHHTRLFSSNHDDRNSTDKSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADEIQSLTNNLCYTYARCTRSVSVVPPAYYAHLAAYRARFYMEPGATEISKARGARSKDGSVRPLPALKEKVKNVMFYC"

     misc_feature    <640..834
                     /gene="LOC112708204"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    862..1014
                     /gene="LOC112708204"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    1015..1359
                     /gene="LOC112708204"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1162..1164,1207..1209,1240..1242,1252..1254,
                     1306..1308,1327..1329,1333..1335)
                     /gene="LOC112708204"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1492..2844
                     /gene="LOC112708204"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1921..1923,1933..1935,1969..1980,1987..1989,
                     2011..2013,2020..2022,2032..2034,2044..2046)
                     /gene="LOC112708204"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2134..2136,2140..2142,2392..2394,2812..2814)
                     /gene="LOC112708204"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

caccacatacatgtgcgtctcttgaggcttcagcttcttcctcttctcacttcactccaacaacctcacattaattaatctccctcctctgacacactccgatccgcataacacaaatacaacacatacctttctttctttcttagcttgctgggcatcaagtgcgtgcgtgcgtgcgtgcactcctttaatcaccctccctctctgcacacactctttttttatgtataaggtgctgaattaaggagagaagagagagagaattttggagaaggtttgaagtgattggatttcacagttatatgcattaaaagctaaggccatagagcagttacaatgaaatatatgcacggcttcagtaataataataataatatcaaatacatgccgtaaactacaaggaaacctattaagcataaacgatgaagtgtgggttgattatgatatgaccagtaggaagctaagaagcagagatagggttgaaggaaagggggggcccctggaaagtgggaaaatttttctgagtaagaaattaactatagatgtgacaaaattgaaagaaagaaagaaagaaatcacattgaccaaagcgtagatcataaaaggagaagcagtcagaaagaatacactgctgccatgcttcctttcacatacaaagagttcactatattattgactgaagatgatgagagtattggtactaccagggaaagagagtttaaggtggtaatcaagtttgctgctcgtgttagcatgcatcaattacgtgagcttctcagtgggaaacaagtggacacaccacaagaagcacttactgttattgacattgttctgagggagcttgcagcacagagttacgtgtccattgggaggtttctgtattctcctgattttagaaaaccacagcagcttggtggtggcttagaatcatggcgtggattctaccaaagtataaggcctacccagatgggtttatcacttaatattgacatgtcatcaatggcgtttattgagccactccctgtgattgactttgttgctcaaattttgggaaaagatgtgcactcaaagccattgtcagatgcagatcgtgtcaagattaagaaggccctaagaggtgtaaaagttgaagttacgcatagagggagttttagaaggaagtacaggatatcaggattgacatcacagccaacaagggagcttaacttccctcttgatgagaaaatgaacatgaaatcagtggttgattattttcaagaaatgtatggatacactatcaagtatcctcatctaccttgtcttcaagtaggaagccaaaagaaggtgaactatttgccaatggaggcatgcaagatagttggaggccagaggtatacaaaagggctaaacgaaaagcagataacttctctcttgaaggtctcatgccagagaccacgcgaacaagagacagatattcttcagacaattcaagaaaatgattatgaatataatccgtatgcgaaagagtttggtataagtgtagacagcaagcttacatcagttgatgctcgggttcttcctgctccatggttgaaatatcatgacactggaagagagaaagagtacttgccacaagttggtcagtggaatatgatgaacaagaaagtaataaatggaagcactgtaagatactgggcatgtatcaatttctcaagaagtgttcaagaaagcacagctcgtggattttgccaacagttagttcagatgtgccaaatctcaggcatggaatttagccaggaccctgtgattcctgtatattcagcaaaacctgatctagttaagaaggctttgaagtatgtacattcagcttctctagaaaatcttggtggcaaggagctagagttgcttattgcaattcttccagacaacaatggctctctatatggtgatctcaaaagaatctgcgaaactgatcttgggttgatttctcagtgttgtcttacaaagcatgtattcaagattaatagacagtacttggcaaatgttgcactcaaaatcaatgtcaagatgggaggaaggaacacagtgcttttggatgctttaagttggaggatcccattggttagtgacattccaacaataatatttggagctgatgtaactcatccagaatccggagaggactcttgtccttccattgctgctgttgtagcctcacaggactggccagaagtaacaaagtacgcaggattggtttgcgcgcagcctcatcgggaagaactcatacaagatctttttaaatgctggaaagatcctcatcatggtgtagtttatggtggcatgatcagagagctcttactctcatttaagaaggcaactggacaaaaaccactgaggataatattttacagggacggggtaagcgaaggacaattctaccaagttttgctatatgaacttgatgccattcgtaaggcttgtgcatctttggaaccaagttaccaacctccagtaacatttgttgtggttcaaaaacgtcatcatactagactcttctcaagcaatcatgatgatagaaatagcactgacaagagtggcaatatcttacctggtactgtggttgattctaagatctgtcatcctacagaatttgacttctatttatgcagtcatgctggaattcagggtacaagtagaccagctcactaccatgtcttatgggatgagaacaatttcactgctgatgaaattcagtctctcaccaacaacttatgctacacttatgcaaggtgtacaagatctgtttcagtagtgcctcctgcatactatgctcatttggcagcataccgagctcgattctacatggaacctggtgccactgagatttctaaagcgcggggtgcaagatcaaaagatggttcagttcggccactcccagctctcaaagaaaaagtcaagaatgtcatgttctactgttgaatatcataagctcaaataaatgagacagagacttcaattgaaattaaacagcaccataggaaaaacaccaagctaaatattagtgatctcatgaaaaactccatcatcatcatcatcatgtacaacaacatatccttgttcatataaattgtatctgattatctctggaaattttgttaagtctagtagcctttttttttcaagtctttgttaccaacacgtgtgatgtagaaattgcttgctttaaagtgcctaaatggtgaaaatcaggttagtatttgtggc

//