2024-04-27 09:30:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_025208054 2406 bp mRNA linear VRT 04-JUN-2018 DEFINITION PREDICTED: Alligator sinensis protein argonaute-1 (LOC102373826), transcript variant X5, mRNA. ACCESSION XM_025208054 VERSION XM_025208054.1 DBLINK BioProject: PRJNA221633 KEYWORDS RefSeq. SOURCE Alligator sinensis (Chinese alligator) ORGANISM Alligator sinensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Crocodylia; Alligatoridae; Alligatorinae; Alligator. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_005842217.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Alligator sinensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2406 /organism="Alligator sinensis" /mol_type="mRNA" /db_xref="taxon:38654" /chromosome="Unknown" /sex="female" /country="China: Changxing Yinjiabian Chinese Alligator Nature Reserve, Zhejiang Province" /collection_date="08-Nov-2010" gene 1..2406 /gene="LOC102373826" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:102373826" CDS 149..2260 /gene="LOC102373826" /codon_start=1 /product="protein argonaute-1 isoform X5" /protein_id="XP_025063839.1" /db_xref="GeneID:102373826" /translation="
MSTQSQQVREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQTFPLLRPLG"
misc_feature 233..457 /gene="LOC102373826" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 485..637 /gene="LOC102373826" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 638..1000 /gene="LOC102373826" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(794..796,839..841,881..883,893..895,947..949, 968..970,974..976) /gene="LOC102373826" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1133..2230 /gene="LOC102373826" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1544..1546,1556..1558,1592..1603,1610..1612, 1634..1636,1643..1645,1655..1657,1667..1669) /gene="LOC102373826" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" ORIGIN
tgccacccttacagcaggtatttcaagcaccacgccggcccgggataggaaccgtcgggaagcccatcaagctcttggccaactactttgaagtggacattcccaagatcgatgtctatcactatgaagtggatatcaaacccgacaaatgtccacgcagagtcaacaggtaagagaggtggtggaatatatggtacaacacttcaaacctcagatcttcggtgaccgcaagccagtatacgatgggaagaaaaacatttacactgtcactgctttgcccattggaaatgaacgggttgactttgaggtaacaattccgggagaaggcaaggacaggatctttaaggtttccataaagtggatggcaatcgtgagctggcggatgctgcatgaagcccttgtgagcgggcagatccctgtccctctggaatcagtccaggcgctggacgtggccatgcgccatctggcttcaatgaggtacactcccgtgggccgctcctttttctctcccccggaaggttactaccacccccttggtgggggcagggaggtttggtttggattccatcagtccgtcaggcctgccatgtggaagatgatgctcaacattgatgtgtcggcaacggctttctacaaagcccagcctgtgattgagttcatgtgcgaagtgctggacatccggaacattgacgagcagccgaagcccctgacggattcacagagggtgcgcttcactaaggagatcaaaggtttgaaagtagaggtgacccactgtgggcagatgaagaggaaataccgtgtgtgtaatgttaccaggcgaccagccagtcaccaaacgttccccctgcagctggagagtggccagactgtggagtgcacggtggctcagtactttaagcagaaatacaacctgcagctgaaatacccccacctaccatgtctgcaggttggccaggaacagaagcacacatacctgccactggaggtgtgtaacattgtggcaggccagcgctgcatcaagaagctaacagacaatcagacgtcaaccatgataaaggcaacagcaaggtccgccccggacaggcaagaggaaatcagccgcctgatgaaaaatgccagttacaacctagatccgtacatacaggagtttgggataaaggtgaaggatgacatgacggaggtgactgggagggtccttcctgcaccaatcctacagtatggaggacggaaccgggcgatcgccactcccaaccagggcgtgtgggatatgcgcgggaagcagttctacaacggcattgagatcaaagtgtgggccatcgcatgctttgcccctcagaagcagtgtcgagaagaggtgctgaagaacttcacagaccagctgcgcaagatatccaaggatgcagggatgccaatccagggacagccatgcttctgtaaatacgcccagggcgcagacagcgtggagcccatgttccgacacctcaaaaacacctactcagggctccagctcatcattgtcatcctaccagggaaaacacccgtgtatgcggaggtaaagcgtgtgggggacacgctcctggggatggccacacagtgtgttcaggtcaagaacgtggtgaagacctctccacaaaccctctccaatctctgcctcaagatcaatgtcaagttgggtggaatcaacaacatcctcgtgcctcatcagcgctcggccgtctttcagcagccagtgattttcctcggagctgatgtcactcacccgccagcaggagatgggaagaagccttccatcacagctgttgtgggcagcatggatgcccacccgagccgttactgtgccacggtgcgtgtgcagcgaccacgacaggagattatcgaggacttgtcatacatggtgagggaacttcttatccagttctacaagtccacccgcttcaagcccaccaggatcatcttctatcgggacggggttcccgaggggcagctcccgcagattcttcactacgagcttctggcaatccgggatgcctgcatcaaactggaaaaggattatcagcctggcatcacctacatagttgtccagaaacggcaccacacccgccttttctgtgcagacaagaacgagaggattggcaagagtggcaacatcccggcaggaacaactgtggataccaacatcacccacccatttgaattcgacttctacctttgcagtcatgcaggcattcagaccttcccattactacgtcctctgggatgacaaccggtttacagcggatgagctgcagatcctcacgtaccagctctgtcacacctatgtgcggtgcacccgctctgtctccatcccagcaccagcatactatgcccggttagtggcattcagggcacgataccacctcgtggaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]