LOCUS       XM_024798724            1375 bp    mRNA    linear   VRT 24-APR-2018
DEFINITION  PREDICTED: Maylandia zebra copper-transporting ATPase 2-like
            (LOC112430427), mRNA.
ACCESSION   XM_024798724
VERSION     XM_024798724.1
DBLINK      BioProject: PRJNA198780
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Maylandia zebra (zebra mbuna)
  ORGANISM  Maylandia zebra
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Cichlomorphae; Cichliformes;
            Cichlidae; African cichlids; Pseudocrenilabrinae; Haplochromini;
            Maylandia; Maylandia zebra complex.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_036801.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Maylandia zebra Annotation Release
                                           104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 5% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1375
                     /organism="Maylandia zebra"
                     /mol_type="mRNA"
                     /isolate="#2_Kocher and #3_Kocher"
                     /db_xref="taxon:106582"
                     /sex="pooled male and female"
                     /dev_stage="adult"
                     /ecotype="Mazinzi reef"
                     /linkage_group="LG23"
     gene            1..1375
                     /gene="LOC112430427"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 95% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:112430427"
     CDS             1..1263
                     /gene="LOC112430427"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_024654492.1"
                     /db_xref="GeneID:112430427"
                     /translation="

MTASFNALQGVLTSATQSSTVTWSVPNSLAKVDYDASVIPTKEIALELQTLGYSVESVVQIRVDGMHCQSCVQSIQGQIGELQGVSHIQVSLQDKAALIVFQPLLVTHEELRDKIEDMGFDTALLSEDPSVEDLSFWQKKEVDASTQTVTILIGGMTCSSCVQTIEGRISQMTGVRFIAVSLEAEKGTITFDPYLTEPEQLRAAIEDMGFDASLKEPIKSVQSHEKSQPVSFGLSDMSTNRPVVSNGTGSQAPSASSPEIKAQKCFICVTGMTCASCVSNIERNLLKHRGIFSVLVSLMAGKAEVKYDSHVLDATAVTELIKDLGFGAKVIEDNAVAHGKLDLTITGMTCASCVHNIESKLNLTRGILMASVALATNKAQVEFDPEVLGPRDIIKLIQGLGFEARLATWQRPQQTMWKST"

     misc_feature    178..363
                     /gene="LOC112430427"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(196..204,211..213)
                     /gene="LOC112430427"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    448..639
                     /gene="LOC112430427"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(466..474,481..483)
                     /gene="LOC112430427"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    805..987
                     /gene="LOC112430427"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(814..822,829..831)
                     /gene="LOC112430427"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1024..1215
                     /gene="LOC112430427"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1042..1050,1057..1059)
                     /gene="LOC112430427"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
ORIGIN      

atgactgcctctttcaatgcattacagggagtgctgacctccgccactcaaagctctactgtcacatggtctgtacccaacagtttggccaaggtggactatgatgcttcagttattccaaccaaagagatcgccctggaactacagaccttgggatacagcgtggagtctgtggtgcagatcagggtggatggtatgcactgccagtcctgtgtgcagtccattcagggacagatcggggagctgcagggggtttcacatattcaggtgtctcttcaggacaaagcagcgctgattgtttttcagcctcttctagtcacacatgaagagctgagagacaaaattgaggacatgggctttgatactgctttgttatctgaggacccatcagtagaagatttaagtttctggcagaaaaaggaggtggatgcctccacccagactgtaaccattttgattggagggatgacttgcagctcttgtgtgcagacaatagaagggaggatctctcagatgactggagtgcggttcatagcggtgtccctggaggcggaaaagggaacaataacctttgatccctatttaacagagccagagcagctcagggcagctattgaggacatgggctttgacgcctcacttaaagaacctataaagagtgttcagagtcatgaaaagtcccagcctgtaagctttggactttctgacatgtcgacaaacaggcctgtagtcagcaatgggacgggttcacaggcaccatctgcaagttcgcctgagataaaagcacagaaatgcttcatctgcgttacggggatgacctgtgcctcctgtgtgtccaacatcgagaggaacctgctcaaacacagaggaatcttctcagtgttggtgtcgctaatggccggtaaggcagaggtgaagtatgattcacatgtcctggatgctactgcagtgactgagctcatcaaagacttgggctttggtgccaaagtgattgaggataatgcagtagcacatggaaagctggacctcactataacaggcatgacgtgcgcatcatgtgtccacaacatcgagtccaagctcaacttaaccagagggatcctcatggcttcggtcgcactggcaaccaacaaagctcaggttgagtttgacccagaggtgctcggacctcgggatattatcaagctcatccagggtcttggatttgaggccaggctggctacatggcagcgtccccagcaaaccatgtggaagtcaacctgaccgcgtagctactcatgcagcaagagatttgtgatgctgtgttttctgaccacagtcctgtgatgcttcaagttcctcttgcccgtacctcagttaaaccgcgctgctgctc

//