GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:43:51, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_024447763            4219 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens transforming acidic coiled-coil containing
            protein 2 (TACC2), transcript variant X25, mRNA.
ACCESSION   XM_024447763
VERSION     XM_024447763.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000010.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4219
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
     gene            1..4219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="transforming acidic coiled-coil containing protein
                     2; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 4 mRNAs, 142 ESTs, 47 long SRA reads, 9
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
     variation       1
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949736791"
     variation       3
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981404472"
     variation       16..17
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1203509893"
     variation       20
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192795609"
     variation       40
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908449369"
     variation       41
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193133228"
     variation       53
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776600076"
     variation       57
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429199747"
     variation       59
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898602883"
     variation       61
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542237873"
     variation       62
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185682553"
     variation       63
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371112179"
     variation       64
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891152794"
     variation       67
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565018724"
     variation       68
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008643574"
     variation       74
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1383631860"
     variation       75
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021241526"
     variation       78
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902739373"
     variation       81
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896720881"
     variation       83
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759136137"
     variation       84
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756798875"
     variation       86
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745326586"
     variation       87
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173514668"
     variation       89
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755669282"
     variation       96
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780679760"
     variation       99
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320471019"
     variation       100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200528686"
     variation       104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372926797"
     variation       105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151268273"
     variation       106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451117201"
     variation       109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774802156"
     variation       110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368679552"
     variation       123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368424069"
     variation       124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376941035"
     CDS             125..3733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /codon_start=1
                     /product="transforming acidic coiled-coil-containing
                     protein 2 isoform X24"
                     /protein_id="XP_024303531.1"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
                     /translation="
MGNENSTSDNQQEDSVLHNVILWPPNPEPTQRTLSAQTPRSAQPPGNSQNIKRKQQDTPGSPDHRDASSSPVADDIIQPAAPADLESPTLAASSYHGDVVGQVSTDLIAQSISPAAAHAGLPPSAAEHIVSPSAPAGDRVEASTPSCPDPAKDLSRSSDSEEAFETPESTTPVKAPPAPPPPPPEVIPEPEVSTQPPPEEPGCGSETVPVPDGPRSDSVEGSPFRPPSHSFSAVFDEDKPIASSGTYNLDFDNIELVDTFQTLEPRASDAKNQEGKVNTRRKSTDSVPISKSTLSRSLSLQASDFDGASSSGNPEAVALAPDAYSTGSSSASSTLKRTKKPRPPSLKKKQTTKKPTETPPVKETQQEPDEESLVPSGENLASETKTESAKTEGPSPALLEETPLEPAVGPKAACPLDSESAEGVVPPASGGGRVQNSPPVGRKTLPLTTAPEAGEVTPSDSGGQEDSPAKGLSVRLEFDYSEDKSSWDNQQENPPPTKKIGKKPVAKMPLRRPKMKKTPEKLDNTPASPPRSPAEPNDIPIAKGTYTFDIDKWDDPNFNPFSSTSKMQESPKLPQQSYNFDPDTCDESVDPFKTSSKTPSSPSKSPASFEIPASAMEANGVDGDGLNKPAKKKKTPLKTMVEDVMSVCSLFDTFRVKKSPKRSPLSDPPSQDPTPAATPETPPVISAVVHATDEEKLAVTNQKWTCMTVDLEADKQDYPQPSDLSTFVNETKFSSPTEGKQLCSQLDPHSASENPAPREPKARRETSQPELDYRNSYEIEYMEKIGSSLPQDDDAPKKQALYLMFDTSQESPVKSSPVRMSESPTPCSGSSFEETEALVNTAAKNQHPVPRGLAPNQESHLQVPEKSSQKELEAMGLGTPSEAIEITAPEGSFASADALLSRLAHPVSLCGALDYLEPDLAEKNPPLFAQKLQEELEFAIMRIEALKLARQIALASRSHQDAKREAAHPTDVSISKTALYSRIGTAEVEKPAGLLFQQPDLDSALQIARAEIITKEREVSEWKDKYEESRREVMEMRKIVAEYEKTIAQMIEDEQREKSVSHQTVQQLVLEKEQALADLNSVEKSLADLFRRYEKMKEVLEGFRKNEEVLKRCAQEYLSRVKKEEQRYQALKVHAEEKLDRANAEIAQVRGKAQQEQAAHQASLRKEQLRVDALERTLEQKNKEIEELTKICDELIAKMGKS"
     misc_feature    <194..790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Atrophin-1 family; Region: Atrophin-1; cl26464"
                     /db_xref="CDD:331285"
     misc_feature    <1250..2413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Domain of unknown function (DUF4045); Region:
                     DUF4045; cl25751"
                     /db_xref="CDD:330572"
     misc_feature    3110..3712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Transforming acidic coiled-coil-containing protein
                     (TACC); Region: TACC; pfam05010"
                     /db_xref="CDD:309929"
     variation       126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349609278"
     variation       134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384553919"
     variation       136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203183802"
     variation       137..138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1269775765"
     variation       145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215968267"
     variation       147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547823080"
     variation       148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886895560"
     variation       150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283714338"
     variation       152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212493882"
     variation       153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773505492"
     variation       158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421978010"
     variation       159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168680390"
     variation       163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043082105"
     variation       164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162984295"
     variation       169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567395106"
     variation       170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458435301"
     variation       181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536431472"
     variation       182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748823611"
     variation       183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389657707"
     variation       187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896032069"
     variation       190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192677940"
     variation       194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350812446"
     variation       203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184660626"
     variation       205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291011051"
     variation       213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323178740"
     variation       214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244843089"
     variation       215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755476481"
     variation       216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991342276"
     variation       219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192689513"
     variation       220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375461398"
     variation       224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307737191"
     variation       232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754559620"
     variation       236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779540446"
     variation       237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753289073"
     variation       239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756120822"
     variation       242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173681722"
     variation       243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758684627"
     variation       247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114344239"
     variation       248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202197379"
     variation       249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccctc"
                     /db_xref="dbSNP:748791718"
     variation       249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138166528"
     variation       250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745896242"
     variation       253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769907900"
     variation       259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774154821"
     variation       260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761870489"
     variation       261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771921628"
     variation       266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375973608"
     variation       267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201980895"
     variation       269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238814181"
     variation       270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766081390"
     variation       275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369830070"
     variation       276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554980725"
     variation       277..281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:753443406"
     variation       278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759087516"
     variation       283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370111299"
     variation       285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764868224"
     variation       286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115077750"
     variation       288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758882459"
     variation       297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540521848"
     variation       298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751908069"
     variation       300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158155825"
     variation       301..302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:763342425"
     variation       301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577387065"
     variation       302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573681653"
     variation       308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200691895"
     variation       313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352400701"
     variation       315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320631404"
     variation       317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393009319"
     variation       322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140883324"
     variation       323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780126824"
     variation       324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749336283"
     variation       325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200367"
     variation       326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760524024"
     variation       328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331467958"
     variation       329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229314757"
     variation       330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272791539"
     variation       335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215713065"
     variation       337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778199158"
     variation       339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249483062"
     variation       343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747563042"
     variation       347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893970982"
     variation       349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757494792"
     variation       350..355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:1419489454"
     variation       355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392599"
     variation       356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396135826"
     variation       357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781643198"
     variation       360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229634950"
     variation       361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545751147"
     variation       362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199955284"
     variation       366..370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1203641585"
     variation       366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775681531"
     variation       367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759031271"
     variation       370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374068486"
     variation       371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772123235"
     variation       373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254753477"
     variation       374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772966997"
     variation       382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042906107"
     variation       385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145341685"
     variation       386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770595283"
     variation       389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776535002"
     variation       390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759153407"
     variation       393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764934219"
     variation       396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372384478"
     variation       398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560859062"
     variation       399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762389768"
     variation       400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763662132"
     variation       403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357162289"
     variation       405..406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:761248045"
     variation       407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751970211"
     variation       410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364004763"
     variation       411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416902470"
     variation       412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757804259"
     variation       413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750857540"
     variation       414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014587081"
     variation       416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:766629490"
     variation       418..428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgttgttggcc"
                     /db_xref="dbSNP:755296347"
     variation       418..425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgttg"
                     /replace="tgttgttg"
                     /db_xref="dbSNP:753935010"
     variation       420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201242530"
     variation       422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276961485"
     variation       428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444420674"
     variation       429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147336554"
     variation       430..431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:765583276"
     variation       431..432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aaagaaagaaagatctacaaaggtttctaaacacttacttgaggtt"
                     /db_xref="dbSNP:1565393487"
     variation       431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367601425"
     variation       432..448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tctctacggatctgata"
                     /db_xref="dbSNP:1565393533"
     variation       432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749537807"
     variation       433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769340180"
     variation       435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779085099"
     variation       438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141016456"
     variation       439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114501786"
     variation       440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382200"
     variation       441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769587453"
     variation       442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481459939"
     variation       443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399803331"
     variation       449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056069"
     variation       450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762623543"
     variation       453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144877654"
     variation       456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762196038"
     variation       457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749174067"
     variation       459..462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1169179342"
     variation       462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768181228"
     variation       470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414490769"
     variation       480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200169711"
     variation       481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565889394"
     variation       482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364062338"
     variation       486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231310621"
     variation       488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055639"
     variation       493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895950254"
     variation       494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534481630"
     variation       495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377123555"
     variation       496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145822203"
     variation       499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923046"
     variation       503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12765679"
     variation       506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220747870"
     variation       507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393560870"
     variation       509..511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:777569322"
     variation       509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340142931"
     variation       512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442203613"
     variation       513..515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746979348"
     variation       516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369648685"
     variation       517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751678488"
     variation       519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142578469"
     variation       520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780024892"
     variation       521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273901341"
     variation       527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753733864"
     variation       528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754737818"
     variation       531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280849029"
     variation       534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778606346"
     variation       540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422902389"
     variation       541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184882845"
     variation       542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770450758"
     variation       544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556529935"
     variation       548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444788385"
     variation       552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344502759"
     variation       553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167402538"
     variation       554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369298895"
     variation       555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191364618"
     variation       557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426135207"
     variation       558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770573957"
     variation       559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350304247"
     variation       562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964403375"
     variation       566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394526091"
     variation       568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150954247"
     variation       569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759990714"
     variation       573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140845862"
     variation       574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775765147"
     variation       576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373555551"
     variation       577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182296008"
     variation       581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251685959"
     variation       586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988631023"
     variation       590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197580486"
     variation       592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267804748"
     variation       598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756957694"
     variation       610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303739623"
     variation       619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767142432"
     variation       625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750095297"
     variation       633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447537978"
     variation       634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198528351"
     variation       637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755521071"
     variation       642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201603538"
     variation       647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1555121169"
     variation       651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140413175"
     variation       652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201214429"
     variation       658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362915299"
     variation       658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555121236"
     variation       659..675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccacccccaccaccccc"
                     /replace="ccacccccaccacccccaccaccccc"
                     /db_xref="dbSNP:34095801"
     variation       659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451142111"
     variation       660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455549169"
     variation       662..666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:1159831976"
     variation       662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384973683"
     variation       663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424586328"
     variation       665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301905535"
     variation       666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755517441"
     variation       667..670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1318215449"
     variation       667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779223549"
     variation       669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565571513"
     variation       670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748566906"
     variation       671..676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1565571647"
     variation       671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773254764"
     variation       672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770879290"
     variation       673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241392502"
     variation       674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776893320"
     variation       675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58106543"
     variation       676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220348519"
     variation       677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765054573"
     variation       678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490814775"
     variation       679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368856332"
     variation       687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313463255"
     variation       688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432963606"
     variation       689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961067010"
     variation       691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765841579"
     variation       694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138045107"
     variation       695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140976774"
     variation       699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382634186"
     variation       702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149503672"
     variation       703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183446641"
     variation       704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364012217"
     variation       709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758645827"
     variation       710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778234573"
     variation       717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532281287"
     variation       718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144751396"
     variation       726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177703431"
     variation       729..743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gatgtggttctgaga"
                     /db_xref="dbSNP:1187559665"
     variation       729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868704474"
     variation       732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565627967"
     variation       734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776454653"
     variation       735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479692439"
     variation       738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948411212"
     variation       742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202010230"
     variation       744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745501319"
     variation       749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769496601"
     variation       754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774860841"
     variation       756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175221066"
     variation       759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762460420"
     variation       762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479278284"
     variation       765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268820302"
     variation       767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763525770"
     variation       768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373068885"
     variation       772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762441531"
     variation       773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402926596"
     variation       776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1284928578"
     variation       777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376162843"
     variation       778..782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtgg"
                     /db_xref="dbSNP:1031378520"
     variation       778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756389507"
     variation       782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329642994"
     variation       785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766688126"
     variation       788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262320291"
     variation       791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866000543"
     variation       797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148110955"
     variation       798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370799288"
     variation       800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216683665"
     variation       801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219899214"
     variation       802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291747880"
     variation       803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361812227"
     variation       804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564717762"
     variation       805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143883746"
     variation       811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780955004"
     variation       812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437946703"
     variation       813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166796802"
     variation       814..818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:773619764"
     variation       817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389808854"
     variation       819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745730679"
     variation       823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769483248"
     variation       824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008585258"
     variation       826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775150815"
     variation       829..830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:761300973"
     variation       829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748916908"
     variation       830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773774461"
     variation       831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762386374"
     variation       832..833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:771538634"
     variation       832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772763191"
     variation       833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761051733"
     variation       836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766662877"
     variation       838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201905665"
     variation       841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759721170"
     variation       843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441037916"
     variation       853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296165600"
     variation       856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375033420"
     variation       860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240305957"
     variation       871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765341262"
     variation       872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176088242"
     variation       874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313678251"
     variation       875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427434133"
     variation       877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357969883"
     variation       878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022571261"
     variation       882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291054240"
     variation       884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964270789"
     variation       885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967106481"
     variation       886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752835692"
     variation       889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773783823"
     variation       893..896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gtgg"
                     /replace="gtggtgg"
                     /db_xref="dbSNP:777232638"
     variation       893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029661399"
     variation       894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183086070"
     variation       900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241309431"
     variation       905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442703845"
     variation       909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165326358"
     variation       914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116183037"
     variation       917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750376265"
     variation       918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755889268"
     variation       920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376786391"
     variation       921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540765159"
     variation       924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560482573"
     variation       930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373908144"
     variation       931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370168206"
     variation       932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529296575"
     variation       942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771710153"
     variation       947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916176525"
     variation       950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213227589"
     variation       954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275492631"
     variation       955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303099860"
     variation       958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773794685"
     variation       962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761282634"
     variation       963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771284294"
     variation       964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462754633"
     variation       965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776913120"
     variation       966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275479836"
     variation       967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549215108"
     variation       975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475016676"
     variation       976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765447651"
     variation       978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181469493"
     variation       981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425362468"
     variation       982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923829"
     variation       983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199696107"
     variation       986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175338836"
     variation       987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254138834"
     variation       990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7083331"
     variation       993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272564235"
     variation       997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191111839"
     variation       999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756044688"
     variation       1001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779876538"
     variation       1002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334222006"
     variation       1003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753632492"
     variation       1006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200529740"
     variation       1009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272291538"
     variation       1010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747813403"
     variation       1011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771655052"
     variation       1012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261569123"
     variation       1014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111994437"
     variation       1015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747532165"
     variation       1018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283604528"
     variation       1021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372635027"
     variation       1024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213489310"
     variation       1031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777051347"
     variation       1036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342604887"
     variation       1041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906864557"
     variation       1045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746155868"
     variation       1046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198381623"
     variation       1055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426827893"
     variation       1059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390452206"
     variation       1062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3750843"
     variation       1066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172685149"
     variation       1067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775643365"
     variation       1069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383528125"
     variation       1070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143340046"
     variation       1072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764129065"
     variation       1073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114995590"
     variation       1076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376178888"
     variation       1078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766292512"
     variation       1079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760159868"
     variation       1083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753817518"
     variation       1087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279050241"
     variation       1090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754669268"
     variation       1091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765143512"
     variation       1092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288126420"
     variation       1093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752353928"
     variation       1094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758161048"
     variation       1096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777412834"
     variation       1097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746572352"
     variation       1099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565631962"
     variation       1101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756797942"
     variation       1102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781496938"
     variation       1104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199969252"
     variation       1114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468212441"
     variation       1116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770104155"
     variation       1117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957496572"
     variation       1120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268321360"
     variation       1121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381505226"
     variation       1123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424544716"
     variation       1126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208559524"
     variation       1127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029876000"
     variation       1134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775874142"
     variation       1146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749489269"
     variation       1147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139376398"
     variation       1149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774482969"
     variation       1152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202246830"
     variation       1153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79619171"
     variation       1155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150034118"
     variation       1158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867989093"
     variation       1162..1167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1447689928"
     variation       1163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868039262"
     variation       1167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866202883"
     variation       1171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759573053"
     variation       1172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1289335828"
     variation       1176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358270530"
     variation       1179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210204744"
     variation       1186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765090078"
     variation       1187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435669586"
     variation       1189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300809535"
     variation       1197..1203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:759725298"
     variation       1198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180009063"
     variation       1202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139868428"
     variation       1203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183608136"
     variation       1205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751241062"
     variation       1211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115286612"
     variation       1213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780787166"
     variation       1215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538567560"
     variation       1216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114199549"
     variation       1224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749720151"
     variation       1225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332128588"
     variation       1227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769011931"
     variation       1231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915739324"
     variation       1239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196937628"
     variation       1241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948515169"
     variation       1243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778943409"
     variation       1244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312917152"
     variation       1246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748421472"
     variation       1247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245301953"
     variation       1248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145907362"
     variation       1251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250514618"
     variation       1253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554116886"
     variation       1260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202181709"
     variation       1267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375248756"
     variation       1269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934338274"
     variation       1271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463797112"
     variation       1275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773378377"
     variation       1276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759521622"
     variation       1278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769922555"
     variation       1279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775575434"
     variation       1280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424854899"
     variation       1281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146669395"
     variation       1282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371630068"
     variation       1283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467391447"
     variation       1289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171725889"
     variation       1296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777280236"
     variation       1297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370832508"
     variation       1302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115985418"
     variation       1303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381295430"
     variation       1309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750005707"
     variation       1310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294603489"
     variation       1313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914335011"
     variation       1314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944637263"
     variation       1315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756607567"
     variation       1319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369583357"
     variation       1322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378317701"
     variation       1325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755283163"
     variation       1329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114927453"
     variation       1330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35913854"
     variation       1331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772383562"
     variation       1334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747020874"
     variation       1340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371355623"
     variation       1342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151005188"
     variation       1343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763017330"
     variation       1346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768305770"
     variation       1347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295873"
     variation       1348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761359884"
     variation       1350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359759378"
     variation       1351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767266341"
     variation       1352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760120159"
     variation       1353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765895151"
     variation       1359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331893143"
     variation       1364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754298643"
     variation       1365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298529946"
     variation       1367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755545115"
     variation       1368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121471"
     variation       1370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775097315"
     variation       1373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753160407"
     variation       1375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312322640"
     variation       1377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015585332"
     variation       1378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758697172"
     variation       1381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150139481"
     variation       1382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138777606"
     variation       1385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556551802"
     variation       1386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295874"
     variation       1390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768698106"
     variation       1391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426135698"
     variation       1393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368777371"
     variation       1397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747907952"
     variation       1399..1404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:765296364"
     variation       1399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771776690"
     variation       1400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298586776"
     variation       1401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364667209"
     variation       1403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434010762"
     variation       1404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295875"
     variation       1405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149346540"
     variation       1406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390363878"
     variation       1407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306390301"
     variation       1411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932746007"
     variation       1412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765839539"
     variation       1413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955968932"
     variation       1414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291676037"
     variation       1419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776164733"
     variation       1422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224202036"
     variation       1423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759943943"
     variation       1426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371850863"
     variation       1427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753159948"
     variation       1432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758745427"
     variation       1433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275295684"
     variation       1436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441479270"
     variation       1438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554653985"
     variation       1439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405097009"
     variation       1442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144863138"
     variation       1443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781409575"
     variation       1444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202168550"
     variation       1445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756151344"
     variation       1447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040284989"
     variation       1448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547042157"
     variation       1453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461134307"
     variation       1455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778850142"
     variation       1456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748058471"
     variation       1459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771859124"
     variation       1460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027256"
     variation       1461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363135915"
     variation       1462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746637680"
     variation       1463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770625460"
     variation       1466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1169750358"
     variation       1467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290989544"
     variation       1470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776111533"
     variation       1471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759031402"
     variation       1474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260219289"
     variation       1475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458324936"
     variation       1476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375927409"
     variation       1477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776030064"
     variation       1478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772054587"
     variation       1483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567258547"
     variation       1485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054109938"
     variation       1486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028950"
     variation       1488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892825068"
     variation       1491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004463763"
     variation       1494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168179643"
     variation       1500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575786348"
     variation       1501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35532970"
     variation       1504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780028150"
     variation       1505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369011900"
     variation       1507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148585687"
     variation       1508..1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:752879677"
     variation       1508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114482287"
     variation       1510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907333113"
     variation       1512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745542749"
     variation       1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769319405"
     variation       1524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774912294"
     variation       1526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763504346"
     variation       1527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769355165"
     variation       1528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203132721"
     variation       1529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775004619"
     variation       1530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762208855"
     variation       1531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198068596"
     variation       1533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212228565"
     variation       1535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003015440"
     variation       1537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114946191"
     variation       1538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477398525"
     variation       1539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295876"
     variation       1540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373331825"
     variation       1543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75938210"
     variation       1544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187285591"
     variation       1546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956189831"
     variation       1549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422377862"
     variation       1551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201583201"
     variation       1553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758324126"
     variation       1555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143290941"
     variation       1566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751522644"
     variation       1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200483"
     variation       1572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373769936"
     variation       1574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745516639"
     variation       1580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769391107"
     variation       1582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779612306"
     variation       1585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748741805"
     variation       1586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211812468"
     variation       1588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388343217"
     variation       1594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126450"
     variation       1596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774947544"
     variation       1602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487895676"
     variation       1603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282699180"
     variation       1607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762439872"
     variation       1608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543214534"
     variation       1610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985529652"
     variation       1614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264979872"
     variation       1615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430980605"
     variation       1620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488422146"
     variation       1622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921705233"
     variation       1623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543134454"
     variation       1625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478746956"
     variation       1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773494596"
     variation       1644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777183522"
     variation       1646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944497773"
     variation       1648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448852295"
     variation       1650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766573375"
     variation       1666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361503258"
     variation       1667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404718695"
     variation       1674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975894274"
     variation       1677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200197716"
     variation       1678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200903142"
     variation       1680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765335838"
     variation       1681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116727041"
     variation       1682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948396343"
     variation       1686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237798802"
     variation       1688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757238700"
     variation       1689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:558512351"
     variation       1691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370847934"
     variation       1694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755943697"
     variation       1695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779516893"
     variation       1697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198989164"
     variation       1703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374042332"
     variation       1704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301866447"
     variation       1705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002609375"
     variation       1712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868694930"
     variation       1713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438395704"
     variation       1714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754496276"
     variation       1719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778605279"
     variation       1720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765911016"
     variation       1724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753269912"
     variation       1729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617869"
     variation       1731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747267478"
     variation       1733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360376530"
     variation       1734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771337694"
     variation       1745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776679676"
     variation       1748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149875675"
     variation       1750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765282692"
     variation       1755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954043928"
     variation       1757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044360808"
     variation       1762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775608705"
     variation       1763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243822780"
     variation       1764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761734973"
     variation       1770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767291670"
     variation       1773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750389683"
     variation       1780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255268589"
     variation       1786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181478921"
     variation       1789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019634630"
     variation       1791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905990877"
     variation       1794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755818965"
     variation       1798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211698784"
     variation       1803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342007948"
     variation       1804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377341447"
     variation       1806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763469698"
     variation       1812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423707190"
     variation       1813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754726978"
     variation       1814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111795908"
     variation       1816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549690"
     variation       1826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473323611"
     variation       1827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:564839203"
     variation       1830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170321699"
     variation       1831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747723437"
     variation       1835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757927053"
     variation       1841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778080991"
     variation       1844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372505760"
     variation       1845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377103453"
     variation       1846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395314344"
     variation       1849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771171727"
     variation       1851
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342098788"
     variation       1864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373771227"
     variation       1867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568460"
     variation       1871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746080998"
     variation       1875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370327996"
     variation       1876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315632999"
     variation       1885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770069199"
     variation       1887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955858634"
     variation       1888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375899573"
     variation       1889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183996280"
     variation       1892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1258869046"
     variation       1894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443397153"
     variation       1898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804346"
     variation       1904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421786447"
     variation       1908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162433155"
     variation       1909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375253951"
     variation       1911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763304795"
     variation       1913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766065502"
     variation       1917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482751047"
     variation       1919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485703"
     variation       1920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753744351"
     variation       1922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372356560"
     variation       1929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764912468"
     variation       1932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145140872"
     variation       1937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337977662"
     variation       1938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116623673"
     variation       1939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928356195"
     variation       1943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311174434"
     variation       1945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569523562"
     variation       1946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186794327"
     variation       1947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565642151"
     variation       1948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346266225"
     variation       1955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216381943"
     variation       1956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757845073"
     variation       1957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312989990"
     variation       1961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1489399224"
     variation       1963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051130"
     variation       1969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194723044"
     variation       1971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266933346"
     variation       1973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781537142"
     variation       1977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036743578"
     variation       1980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267602392"
     variation       1983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746165255"
     variation       1984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770159087"
     variation       1985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143162487"
     variation       1990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763545893"
     variation       1991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768585905"
     variation       1992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774537634"
     variation       1994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760516162"
     variation       1995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147830187"
     variation       1998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384589949"
     variation       2009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868858086"
     variation       2011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776710818"
     variation       2012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552066251"
     variation       2015..2027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aagaagaaga"
                     /replace="aagaagaagaaga"
                     /replace="aagaagaagaagaaga"
                     /db_xref="dbSNP:763225454"
     variation       2016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239985315"
     variation       2026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571963100"
     variation       2028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907564066"
     variation       2029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762718237"
     variation       2032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763502836"
     variation       2040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940269349"
     variation       2041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320336169"
     variation       2044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763735660"
     variation       2048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220226175"
     variation       2053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773893094"
     variation       2054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761267022"
     variation       2055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464691792"
     variation       2056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757418305"
     variation       2059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565690794"
     variation       2060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750900794"
     variation       2063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756660624"
     variation       2069..2073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1214263040"
     variation       2073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766713597"
     variation       2076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754292582"
     variation       2083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776350847"
     variation       2086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755319544"
     variation       2100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765550124"
     variation       2101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577237580"
     variation       2102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192448554"
     variation       2105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325364389"
     variation       2108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200244150"
     variation       2109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141312062"
     variation       2110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052019119"
     variation       2112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243462986"
     variation       2114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911861882"
     variation       2115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565655710"
     variation       2121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779997033"
     variation       2124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749217706"
     variation       2127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382353255"
     variation       2128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430079078"
     variation       2130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178012692"
     variation       2133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768469173"
     variation       2135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778624614"
     variation       2140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879004195"
     variation       2141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767624278"
     variation       2143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142595789"
     variation       2144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971377205"
     variation       2145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051132992"
     variation       2151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756220208"
     variation       2152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373229304"
     variation       2153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168974129"
     variation       2156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116132466"
     variation       2161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213747876"
     variation       2165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758150082"
     variation       2166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438338538"
     variation       2170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746649237"
     variation       2173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364796890"
     variation       2179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472673300"
     variation       2182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908637736"
     variation       2184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201442031"
     variation       2185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780903530"
     variation       2194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139131571"
     variation       2197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377572872"
     variation       2200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330722147"
     variation       2218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769368467"
     variation       2224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749854819"
     variation       2226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538432507"
     variation       2227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774916657"
     variation       2233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243751002"
     variation       2237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898397711"
     variation       2238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34944231"
     variation       2239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767565546"
     variation       2241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256793659"
     variation       2243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150404273"
     variation       2249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766476440"
     variation       2254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453396717"
     variation       2255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251833616"
     variation       2256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752599030"
     variation       2258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758378142"
     variation       2263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420340279"
     variation       2277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376263819"
     variation       2280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370266697"
     variation       2281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35095099"
     variation       2283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376331548"
     variation       2286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375024095"
     variation       2287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745566133"
     variation       2289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658158"
     variation       2290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149645012"
     variation       2294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749802502"
     variation       2298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866276961"
     variation       2301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395262725"
     variation       2302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769356942"
     variation       2308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565662328"
     variation       2311..2317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgagacc"
                     /replace="cgagaccgagacc"
                     /db_xref="dbSNP:1371086471"
     variation       2311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774923755"
     variation       2313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748401716"
     variation       2315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013086937"
     variation       2317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277178257"
     variation       2320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772504256"
     variation       2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868356760"
     variation       2325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773263407"
     variation       2328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760995785"
     variation       2330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344881290"
     variation       2337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199102821"
     variation       2339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766423134"
     variation       2347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776748439"
     variation       2350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193296515"
     variation       2352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759272845"
     variation       2353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763964743"
     variation       2355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751537684"
     variation       2364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756964036"
     variation       2365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971347545"
     variation       2368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988464159"
     variation       2371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377104806"
     variation       2373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767389236"
     variation       2374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377709607"
     variation       2375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359370122"
     variation       2377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755891566"
     variation       2378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914245134"
     variation       2379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201276357"
     variation       2380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753328740"
     variation       2381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232820202"
     variation       2387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10444046"
     variation       2389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562449796"
     variation       2390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368244421"
     variation       2393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778249068"
     variation       2395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486948357"
     variation       2397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747217424"
     variation       2398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534517363"
     variation       2399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776853407"
     variation       2401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759564463"
     variation       2402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396790368"
     variation       2403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72840893"
     variation       2407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565663392"
     variation       2408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769893527"
     variation       2411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191972822"
     variation       2413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565114496"
     variation       2414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289076160"
     variation       2422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419170864"
     variation       2423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389475433"
     variation       2437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771981610"
     variation       2438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956752475"
     variation       2443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473981288"
     variation       2445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773293574"
     variation       2450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565690430"
     variation       2451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867288575"
     variation       2452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146144060"
     variation       2454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373895280"
     variation       2455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753506322"
     variation       2457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356739937"
     variation       2464
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750288599"
     variation       2466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759309486"
     variation       2468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407206360"
     variation       2469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12268154"
     variation       2472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467568269"
     variation       2481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302564812"
     variation       2484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764639479"
     variation       2485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752316295"
     variation       2487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757848963"
     variation       2492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317421107"
     variation       2496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779179692"
     variation       2498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552517660"
     variation       2500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771056377"
     variation       2501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776714808"
     variation       2503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138976635"
     variation       2504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262025"
     variation       2505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236227348"
     variation       2507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303801895"
     variation       2508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376832058"
     variation       2509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762563927"
     variation       2511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369295547"
     variation       2512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773920791"
     variation       2513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447130895"
     variation       2518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212473116"
     variation       2521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761319926"
     variation       2522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748599613"
     variation       2535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268085020"
     variation       2542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435239520"
     variation       2544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194666228"
     variation       2545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268502166"
     variation       2547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453432073"
     variation       2549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185556095"
     variation       2556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363639492"
     variation       2557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767958887"
     variation       2560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142125896"
     variation       2561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147714181"
     variation       2569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114701221"
     variation       2570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534941686"
     variation       2575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373168589"
     variation       2576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139196844"
     variation       2579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188626786"
     variation       2580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115880388"
     variation       2582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781226002"
     variation       2584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334995033"
     variation       2589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745833341"
     variation       2591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543630960"
     variation       2592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350887064"
     variation       2593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779772714"
     variation       2594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270664849"
     variation       2595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61730787"
     variation       2596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774010181"
     variation       2598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922043946"
     variation       2599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436479863"
     variation       2601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772560651"
     variation       2602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771598263"
     variation       2603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377342486"
     variation       2604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761132977"
     variation       2619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761236862"
     variation       2623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771274057"
     variation       2629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914900340"
     variation       2633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777206576"
     variation       2639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969334372"
     variation       2640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564397839"
     variation       2643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288294653"
     variation       2644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775833159"
     variation       2646..2652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgc"
                     /replace="ctgctgc"
                     /db_xref="dbSNP:1230344014"
     variation       2648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271256611"
     variation       2649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763325586"
     variation       2651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764232214"
     variation       2652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111666066"
     variation       2653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751529875"
     variation       2655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233166862"
     variation       2664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757374526"
     variation       2667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259806348"
     variation       2669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766182197"
     variation       2674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753808693"
     variation       2675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754732462"
     variation       2676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453598568"
     variation       2687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778724348"
     variation       2692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376976062"
     variation       2698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371140295"
     variation       2702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777485343"
     variation       2703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746443975"
     variation       2707..2710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gcag"
                     /db_xref="dbSNP:1382193243"
     variation       2707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770495746"
     variation       2708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776962329"
     variation       2709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370858692"
     variation       2711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200541273"
     variation       2717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770269399"
     variation       2718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577886780"
     variation       2722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359145924"
     variation       2727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238683112"
     variation       2730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930801970"
     variation       2732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004976434"
     variation       2737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203463385"
     variation       2738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565704868"
     variation       2741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763416174"
     variation       2744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775393485"
     variation       2746..2748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1248601100"
     variation       2751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467925153"
     variation       2755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201932773"
     variation       2757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114249776"
     variation       2758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267979086"
     variation       2759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761762767"
     variation       2760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528927715"
     variation       2762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753749581"
     variation       2768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361658773"
     variation       2772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150511831"
     variation       2773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944965247"
     variation       2776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1394419746"
     variation       2784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292604781"
     variation       2786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765099062"
     variation       2787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201040344"
     variation       2788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291974723"
     variation       2789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912402928"
     variation       2790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762614578"
     variation       2791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763989975"
     variation       2792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542534555"
     variation       2796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182505507"
     variation       2799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256343345"
     variation       2805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762526471"
     variation       2811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780998441"
     variation       2815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61753076"
     variation       2816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185164847"
     variation       2818..2824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cctc"
                     /replace="cctcctc"
                     /db_xref="dbSNP:1564726084"
     variation       2821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749844633"
     variation       2822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356683962"
     variation       2824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564726248"
     variation       2826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313969799"
     variation       2830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768884400"
     variation       2831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430780689"
     variation       2833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779388403"
     variation       2837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748310126"
     variation       2842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569372372"
     variation       2843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773434164"
     variation       2853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138735982"
     variation       2854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771028132"
     variation       2855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293319065"
     variation       2856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775373741"
     variation       2858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002413226"
     variation       2865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:751739873"
     variation       2868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279203734"
     variation       2878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762996567"
     variation       2879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763792326"
     variation       2881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751302440"
     variation       2882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474776848"
     variation       2886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761527720"
     variation       2889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392517494"
     variation       2890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089235"
     variation       2892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450511448"
     variation       2896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147846497"
     variation       2898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393510937"
     variation       2900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436876678"
     variation       2901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658202"
     variation       2904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344731089"
     variation       2905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428702141"
     variation       2908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754283055"
     variation       2909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539421583"
     variation       2911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444411645"
     variation       2920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779289414"
     variation       2922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302344524"
     variation       2926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414468282"
     variation       2927..2937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagtt"
                     /replace="gagttagagtt"
                     /db_xref="dbSNP:767240818"
     variation       2932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:750417298"
     variation       2933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336186671"
     variation       2939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771984054"
     variation       2940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865827548"
     variation       2944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412881261"
     variation       2948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567347253"
     variation       2949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760546620"
     variation       2950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1388437775"
     variation       2951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992998683"
     variation       2952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765996074"
     variation       2953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532141781"
     variation       2969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1334932533"
     variation       2971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776167726"
     variation       2973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289795919"
     variation       2976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350620257"
     variation       2978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232104837"
     variation       2981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376705581"
     variation       2984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271866439"
     variation       2986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564735508"
     variation       2993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759045351"
     variation       2994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764692213"
     variation       2997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375657472"
     variation       3001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753223988"
     variation       3002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436428056"
     variation       3012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758961340"
     variation       3018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300712545"
     variation       3019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141377067"
     variation       3024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396085567"
     variation       3027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484129399"
     variation       3033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767823235"
     variation       3036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750641625"
     variation       3037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145232984"
     variation       3038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295878"
     variation       3042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867736580"
     variation       3044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753914817"
     variation       3051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232416465"
     variation       3054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755134815"
     variation       3055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007551291"
     variation       3056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777816912"
     variation       3058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746985859"
     variation       3061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770738881"
     variation       3066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148958039"
     variation       3067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745530967"
     variation       3068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776539571"
     variation       3069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597676"
     variation       3071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775145955"
     variation       3073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762408075"
     variation       3074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61753077"
     variation       3075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866260474"
     variation       3079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762281778"
     variation       3080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295879"
     variation       3082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761809326"
     variation       3087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176369997"
     variation       3088..3089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:747741502"
     variation       3090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370782961"
     variation       3095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766663899"
     variation       3098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368553884"
     variation       3103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536628094"
     variation       3113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866691058"
     variation       3119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755079853"
     variation       3121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765459460"
     variation       3122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75671139"
     variation       3125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145179415"
     variation       3131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252684363"
     variation       3134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139008883"
     variation       3135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336971324"
     variation       3137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745600319"
     variation       3145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268666853"
     variation       3146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538968585"
     variation       3149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189176188"
     variation       3152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449661928"
     variation       3153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779648529"
     variation       3156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448067248"
     variation       3157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748986288"
     variation       3158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747566067"
     variation       3165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771648191"
     variation       3166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369002161"
     variation       3169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564793181"
     variation       3172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975775977"
     variation       3177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291433586"
     variation       3185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377060915"
     variation       3198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747603637"
     variation       3205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912316468"
     variation       3214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771411616"
     variation       3216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372697264"
     variation       3223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227342028"
     variation       3224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978317426"
     variation       3235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564820315"
     variation       3236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75080758"
     variation       3237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370762796"
     variation       3238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746194917"
     variation       3240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770322124"
     variation       3247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775552173"
     variation       3250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142193513"
     variation       3255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423272950"
     variation       3256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867489356"
     variation       3265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768612291"
     variation       3269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176806548"
     variation       3272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774419561"
     variation       3275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761890514"
     variation       3277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318429487"
     variation       3280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478990548"
     variation       3283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368788180"
     variation       3284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762669751"
     variation       3292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414112797"
     variation       3295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602393"
     variation       3297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470506018"
     variation       3299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763754108"
     variation       3301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751297161"
     variation       3304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406827536"
     variation       3306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226848799"
     variation       3307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756806235"
     variation       3309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019037833"
     variation       3312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407465849"
     variation       3313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309376878"
     variation       3315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576383974"
     variation       3317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750960872"
     variation       3327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756574052"
     variation       3349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358939475"
     variation       3350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780436891"
     variation       3355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545114672"
     variation       3367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589274"
     variation       3368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146365438"
     variation       3380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252717696"
     variation       3385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114739516"
     variation       3386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772127891"
     variation       3394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527587471"
     variation       3401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747065222"
     variation       3403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149487619"
     variation       3411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143941520"
     variation       3412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343531337"
     variation       3418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762769351"
     variation       3421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170065040"
     variation       3424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396657872"
     variation       3426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763843707"
     variation       3430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774133362"
     variation       3434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761622230"
     variation       3435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767282216"
     variation       3436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749892480"
     variation       3437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755599004"
     variation       3448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760029955"
     variation       3457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765741125"
     variation       3459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190199335"
     variation       3462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262009486"
     variation       3465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432296611"
     variation       3466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753003533"
     variation       3469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564874083"
     variation       3472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758787417"
     variation       3474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480448917"
     variation       3476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159111751"
     variation       3480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777932612"
     variation       3482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751771255"
     variation       3483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372413580"
     variation       3496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781195910"
     variation       3510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385348085"
     variation       3515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303647079"
     variation       3521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237279577"
     variation       3525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745963821"
     variation       3526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554081729"
     variation       3528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779013734"
     variation       3529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376082640"
     variation       3538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213968702"
     variation       3539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772029008"
     variation       3541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406473528"
     variation       3542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261162550"
     variation       3544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1488018630"
     variation       3552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746827175"
     variation       3564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770435787"
     variation       3565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309438773"
     variation       3567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776369229"
     variation       3573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564879870"
     variation       3574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177930005"
     variation       3579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547685475"
     variation       3580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567661733"
     variation       3581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745678131"
     variation       3585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316975899"
     variation       3586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359848003"
     variation       3596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227277077"
     variation       3597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763517853"
     variation       3598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368557628"
     variation       3599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114931291"
     variation       3602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694570"
     variation       3603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1482596204"
     variation       3610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373294737"
     variation       3612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56075957"
     variation       3613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915433777"
     variation       3616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934534722"
     variation       3617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449221633"
     variation       3618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186937744"
     variation       3619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752680886"
     variation       3626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410614727"
     variation       3633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758346924"
     variation       3635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357493288"
     variation       3636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464517939"
     variation       3638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777783896"
     variation       3639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383284248"
     variation       3640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780060707"
     variation       3641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757107024"
     variation       3642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363564488"
     variation       3646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780680174"
     variation       3653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745570983"
     variation       3654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769288113"
     variation       3655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201638112"
     variation       3656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166152334"
     variation       3662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376457806"
     variation       3668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564914901"
     variation       3676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276851285"
     variation       3678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220908859"
     variation       3690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768248413"
     variation       3703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779260986"
     variation       3704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311935453"
     variation       3706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748744464"
     variation       3709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772316313"
     variation       3716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773647485"
     variation       3728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360412716"
     variation       3732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771233836"
     variation       3734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866915985"
     variation       3736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777028253"
     variation       3737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902027065"
     variation       3739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172721621"
     variation       3742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759504397"
     variation       3743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377142183"
     variation       3746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351888215"
     variation       3747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416840704"
     variation       3749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187544287"
     variation       3757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751439925"
     variation       3758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:547512577"
     variation       3760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361936110"
     variation       3764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223497421"
     variation       3766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3763763"
     variation       3767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750169900"
     variation       3772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755933143"
     variation       3774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234496958"
     variation       3779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374823698"
     variation       3780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777282532"
     variation       3781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201048578"
     variation       3782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753572151"
     variation       3783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006629992"
     variation       3785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754430244"
     variation       3787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549316"
     variation       3788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369424351"
     variation       3793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747619110"
     variation       3794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772575740"
     variation       3800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778450017"
     variation       3807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046622000"
     variation       3809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447930166"
     variation       3811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282865623"
     variation       3816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341499"
     variation       3819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771462938"
     variation       3822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759862926"
     variation       3824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769760312"
     variation       3827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775580610"
     variation       3831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275047558"
     variation       3834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181521772"
     variation       3835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569504865"
     variation       3838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750399176"
     variation       3839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959269055"
     variation       3840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446174545"
     variation       3847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416315388"
     variation       3850..3852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1183854936"
     variation       3850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389099504"
     variation       3859..3866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="taaa"
                     /replace="taaataaa"
                     /db_xref="dbSNP:751463672"
     variation       3860..3868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:774569712"
     variation       3863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169201175"
     variation       3867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760437099"
     variation       3869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766216318"
     variation       3872..3874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1458552102"
     variation       3872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272959843"
     variation       3874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753425741"
     variation       3875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219898335"
     variation       3884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748877620"
     variation       3886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408793518"
     variation       3895..3897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:1453790729"
     variation       3899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:762007046"
     variation       3900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363223209"
     variation       3904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024739984"
     variation       3916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374062655"
     variation       3932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966946959"
     variation       3934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977836267"
     variation       3937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270884083"
     variation       3944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344366660"
     variation       3952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199822541"
     variation       3967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778446734"
     variation       3968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462490128"
     variation       3973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370234122"
     variation       3975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203996663"
     variation       3980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168452"
     variation       3981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291714220"
     variation       3993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036258557"
     variation       3998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459287529"
     variation       4007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898819681"
     variation       4021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224122716"
     variation       4028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165778617"
     variation       4030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778166644"
     variation       4037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419286233"
     variation       4043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262422910"
     variation       4047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180522218"
     variation       4050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440380617"
     variation       4072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321148976"
     variation       4078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189949768"
     variation       4079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028662571"
     variation       4082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305248145"
     variation       4086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032499439"
     variation       4088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350982712"
     variation       4096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287705618"
     variation       4098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:878864233"
     variation       4099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:15151"
     variation       4104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240327071"
     variation       4107..4109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:957852098"
     variation       4113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747511945"
     variation       4114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388396106"
     variation       4123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368077329"
     variation       4125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770390619"
     variation       4129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185822401"
     variation       4134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558060686"
     variation       4135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967563460"
     variation       4142..4146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:910920936"
     variation       4147..4153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:112509232"
     variation       4147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191421130"
     variation       4148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976351124"
     variation       4151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160673944"
     variation       4155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420425324"
     variation       4162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:35785098"
     variation       4164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977657785"
     variation       4165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174596543"
     variation       4180..4193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tctctattgtaaat"
                     /db_xref="dbSNP:1435360193"
     variation       4182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268515894"
     variation       4183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193473691"
     variation       4195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487511484"
     variation       4197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929454719"
     variation       4198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033234149"
     variation       4212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047929684"
     variation       4216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147236944"
ORIGIN      
agtgctgaaaaggagcctctggaagagagggccttctcccgcttctctcctcctcctctccacgctggggggatcctggtcacctctgacaaaattctggggacgctgggaacactgaatcaacatgggcaatgagaacagcacctcggacaaccagcaggaggactccgtcttgcataacgtcattctgtggcctccaaaccctgagcccacacagaggactttatcagctcagactccaaggtccgcgcagccacccgggaacagtcagaatataaaaaggaagcagcaggacacgcccggaagccctgaccacagagacgcgtccagttcacctgtggcagatgatatcatccagcccgctgcccccgcagacctggaaagcccaaccttagctgcctcttcctaccacggtgatgttgttggccaggtctctacggatctgatagcccagagcatctccccagctgctgcccatgcgggtcttcctccctcggctgcagaacacatagtttcgccatctgccccagctggtgacagagtagaagcttccactccctcctgcccagatccggccaaggacctcagcaggagttccgattctgaagaggcatttgagaccccggagtcaacgacccctgtcaaagctccgccagctccacccccaccaccccccgaagtcatcccagaacccgaggtcagcacacagccacccccggaagaaccaggatgtggttctgagacagtccctgtccctgatggcccacggagcgactcggtggaaggaagtcccttccgtcccccgtcacactccttctctgccgtcttcgatgaagacaagccgatagccagcagtgggacttacaacttggactttgacaacattgagcttgtggatacctttcagaccttggagcctcgtgcctcagacgctaagaatcaggagggcaaagtgaacacacggaggaagtccacggattccgtccccatctctaagtctacactgtcccggtcgctcagcctgcaagccagtgactttgatggtgcttcttcctcaggcaatcccgaggccgtggcccttgccccagatgcatatagcacgggttccagcagtgcttctagtacccttaagcgaactaaaaaaccgaggccgccttccttaaaaaagaaacagaccaccaagaaacccacagagacccccccagtgaaggagacgcaacaggagccagatgaagagagccttgtccccagtggggagaatctagcatctgagacgaaaacggaatctgccaagacggaaggtcctagcccagccttattggaggagacgccccttgagcccgctgtggggcccaaagctgcctgccctctggactcagagagtgcagaaggggttgtccccccggcttctggaggtggcagagtgcagaactcaccccctgtcgggaggaaaacgctgcctcttaccacggccccggaggcaggggaggtaaccccatcggatagcggggggcaagaggactctccagccaaagggctctccgtaaggctggagtttgactattctgaggacaagagtagttgggacaaccagcaggaaaacccccctcctaccaaaaagataggcaaaaagccagttgccaaaatgcccctgaggaggccaaagatgaaaaagacacccgagaaacttgacaacactcctgcctcacctcccagatcccctgctgaacccaatgacatccccattgctaaaggtacttacacctttgatattgacaagtgggatgaccccaattttaaccctttttcttccacctcaaaaatgcaggagtctcccaaactgccccaacaatcatacaactttgacccagacacctgtgatgagtccgttgacccctttaagacatcctctaagacccccagctcaccttctaaatccccagcctcctttgagatcccagccagtgctatggaagccaatggagtggacggggatgggctaaacaagcccgccaagaagaagaagacgcccctaaagacgatggttgaagatgtgatgtctgtgtgttctctgtttgacacatttagggtgaaaaagtcgccaaaacggtctcctctctctgatccaccttcccaggaccccaccccagctgctacaccagaaacaccaccagtgatctctgcggtggtccacgccacagatgaggaaaagctggcggtcaccaaccagaagtggacgtgcatgacagtggacctagaggctgacaaacaggactacccgcagccctcggacctgtccacctttgtaaacgagaccaaattcagttcacccactgagggtaagcaactctgtagccagctggacccccactctgcctcggagaatcctgcccctagggagccaaaggccaggagagaaacttctcagccagagttggattacagaaactcctatgaaattgaatatatggagaaaattggctcctccttacctcaggacgacgatgccccgaagaagcaggccttgtaccttatgtttgacacttctcaggagagccctgtcaagtcatctcccgtccgcatgtcagagtccccgacgccgtgttcagggtcaagttttgaagagactgaagcccttgtgaacactgctgcgaaaaaccagcatcctgtcccacgaggactggcccctaaccaagagtcacacttgcaggtgccagagaaatcctcccagaaggagctggaggccatgggcttgggcaccccttcagaagcgattgaaattacagctcccgagggctcctttgcctctgctgacgccctcctcagcaggctagctcaccccgtctctctctgtggtgcacttgactatctggagcccgacttagcagaaaagaaccccccactattcgctcagaaactccaggaggagttagagtttgccatcatgcggatagaagccctgaagctggccaggcagattgctttggcttcccgcagccaccaggatgccaagagagaggctgctcacccaacagacgtctccatctccaaaacagccttgtactcccgcatcgggaccgctgaggtggagaaacctgcaggccttctgttccagcagcccgacctggactctgccctccagatcgccagagcagagatcataaccaaggagagagaggtctcagaatggaaagataaatatgaagaaagcaggcgggaagtgatggaaatgaggaaaatagtggccgagtatgagaagaccatcgctcagatgatagaggacgaacagagagagaagtcagtctcccaccagacggtgcagcagctggttctggagaaggagcaagccctggccgacctgaactccgtggagaagtctctggccgacctcttcagaagatatgagaagatgaaggaggtcctagaaggcttccgcaagaatgaagaggtgttgaagagatgtgcgcaggagtacctgtcccgggtgaagaaggaggagcagaggtaccaggccctgaaggtgcacgcggaggagaaactggacagggccaatgctgagattgctcaggttcgaggcaaggcccagcaggagcaagccgcccaccaggccagcctgcggaaggagcagctgcgagtggacgccctggaaaggacgctggagcagaagaataaagaaatagaagaactcaccaagatttgtgacgaactgattgccaaaatggggaaaagctaactctgaaccgaatgttttggacttaactgttgcgtgcaatatgaccgtcggcacactgctgttcctccagttccatggacaggttctgttttcactttttcgtatgcactactgtatttcctttctaaataaaattgatttgattgtatgcagtactaaggagactatcagaatttcttgctattggtttgcattttcctagtataattcatagcaagttgacctcagagttcctgtatcagggagattgtctgattctctaataaaagacacattgctgaccttggccttgccctttgtacacaagttcccagggtgagcagcttttggatttaatatgaacatgtacagcgtgcatagggactcttgccttaaggagtgtaaacttgatctgcatttgctgatttgtttttaaaaaaacaagaaatgcatgtttcaaataaaattctctattgtaaataaaattttttctttggatcttggcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]