GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 15:02:03, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_024231958            4008 bp    mRNA    linear   PRI 28-FEB-2018
DEFINITION  PREDICTED: Pongo abelii NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), mRNA.
ACCESSION   XM_024231958
VERSION     XM_024231958.1
DBLINK      BioProject: PRJNA37793
KEYWORDS    RefSeq.
SOURCE      Pongo abelii (Sumatran orangutan)
  ORGANISM  Pongo abelii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Pongo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_036917.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pongo abelii Annotation Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4008
                     /organism="Pongo abelii"
                     /mol_type="mRNA"
                     /isolate="Susie"
                     /bio_material="Coriell PR01109"
                     /db_xref="taxon:9601"
                     /chromosome="14"
                     /sex="female"
                     /dev_stage="adult"
     gene            1..4008
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 mRNAs, 141 ESTs, 1 long SRA
                     read, 6 Proteins, and 95% coverage of the annotated
                     genomic feature by RNAseq alignments, including 6 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:100434160"
     CDS             232..3726
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_024087726.1"
                     /db_xref="GeneID:100434160"
                     /translation="
MALFPAFAGLSEAPDGGSSRKELDWLSNPSFCVGSITSLSQQTEAAPAHVSEGSPLTRSHLKSESSDESDTNKKLKQTSRKKKKEKKKKRKRQYHKKTKRKHGPSSSSRSETDTDSEKDKPSRGVGGSKKESEKPNQGNNAAADTGHRFVWLEDIQAVTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGTSTEKKHSRKQVERYFTKKSVGLMNIDGVAISSKTEPPSSEPISFIPVKDLEDAAPVTTWLNPLGIYDQSTTQWLQGQGPPEQESKQPDAQPGSESAALKAKVEEFNRRVRENPRDTQLWMAFVAFQDEVMKSPGLYAIEEGEQEKRKRSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCTEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIHSLYGKCLSTLSAVKDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWKAWMHQQERGGWVVINPDEDDDEPEEDDQEIKDKTLPRWQIWLAAERSRDQRHWQPWRPEKTKKQTEEDCEDPERQVLFDDIGQSLIRLCSHDLQFQLVEAFLQFLGVPSGFTPPASCLYLAMDENSIFDNGLYDEKPLTFFNPSFSGASCVGRMDRLGCPRWTRGQNREGEEFIRNVFHLVMPLFSGKEKSQLCFSWLQYEIAKVIWCLHPKNKKRLKSQGKNCKKLAKNLLKEPENCNNFCLWKQYAHLEWLLGNTEDARKVFDTALGMAGSRELKDSDLCELSLLYAELEVELSPEVRGAATARAVHILTKLTESSPYGPYAGQVSAVRILKARKAYEHALQDCLGDSCVSDPAPTDSCSRLISLAKCFMLFQYLTIGIDAAVRIYEQVFAKLNSSVFPEGSGEGDSASSQSWTSVLEAITLMHTSLLRFHMKVSVYPLAPLREALSQALKLYPGNQVLWRSYVQIQNKSHSASKTRRFFDTITRSAKPLEPWLFAIEAEKLRKRLVETVQRLDGREIHATIPETGLMHRIQALFENAMRSDSGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    1168..1986
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
ccccttggccccgccctgccctgctttgccctgcctctccctgccccgccgcgcccccgtcccttgacgaccctcctctctgggccgcccctcccgcttcggggtcaagccccagagagcgccgcgaaaaccacatttcccagagtgcaccgcgacggcaggggtcctcagaccggcgctcgctcgccggcgccatctctatagagaagaacggcggggcggcctgtggtcatggcgctgttcccagcgtttgcggggcttagtgaggctcccgatggcgggagctccagaaaagagttagactggctgagcaacccgagcttttgtgttggatccataacgtccctgagccaacaaactgaagcagccccagcccatgtttctgaagggtcaccgctgaccaggagtcatctgaaatcagagtcttcagatgaaagtgacactaacaaaaagctcaaacaaacaagcagaaaaaagaagaaagagaaaaagaaaaaaaggaagcgtcagtatcataagaaaacaaagaggaagcatgggccgtcgagtagcagcaggtctgagacagacaccgattctgaaaaggacaaaccttccagaggcgtcggaggcagtaaaaaggaatctgagaaaccgaatcaaggaaataatgctgcagctgatactggacatcgctttgtttggcttgaggacattcaggctgtgacgggagaaaccttcagaacagataagaaaccagatcctgcgaactgggagtacaagtctctctacagaggggatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcttgggaagggacttccacagagaagaagcattcacgcaagcaggttgaacgctattttactaagaagagtgtgggattaatgaacatcgatggagttgccattagcagtaaaactgaacctccctcatctgagcccatctcctttataccagtgaaggacttggaagatgcggctcctgttacaacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacagggtcctccagagcaggaatcaaagcagccagacgcacagccaggcagcgagagtgcggctctcaaagccaaggtggaggagtttaacaggagggtgcgggagaatcctcgggatacgcagctatggatggcattcgttgcttttcaggacgaggtcatgaaaagtcctggcctgtatgccatcgaggaaggagagcaggaaaagcgaaagaggtccctgaagctcattctggagaagaagctggccattctggagcgggccattgagagcaaccagagcagtgtggatctgaaactggccaagctgaagctctgcacagagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttgcatcccaataatacagccctttggcagaaataccttttattttgccagagccagtttagtaccttttcgatatcaaaaattcacagtctttatggaaaatgcttgagcactttgtctgctgttaaggatggcagcatcttatctcaccctgcgttgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccactttctgcggcaggctggccactctgagaaggccgtctcattgttccaggccatggtggacttcaccttcttcaaacctgacagcgtgaaagatctgcctaccaaaggacaggtggaattctttgagcccttttgggacagtggagagccccgggctggggagaagggagcccgaggctggaaggcgtggatgcaccagcaggaacgaggtggctgggtggtcatcaacccagatgaggatgacgatgaaccagaagaggatgaccaggaaataaaagataagactctgcccaggtggcagatctggcttgctgctgagcgttcccgtgaccagaggcactggcagccctggcgtcctgaaaagaccaagaagcaaaccgaggaagactgtgaggatcccgagagacaggtgttgtttgatgatattgggcagtctttgatcagactttgcagccacgatcttcagttccagctggtggaggccttcctgcagttcttgggtgtgccttctggctttactcctccagcctcctgtctttatctggccatggatgagaacagcatctttgataatggactttatgatgaaaagcccttgacttttttcaacccttcattttctggggctagctgtgttggccgcatggataggttaggctgtcctcgctggaccaggggtcagaaccgagagggcgaggagttcatccgcaatgtcttccaccttgtcatgcctttgttttcaggcaaagagaagtcccagctctgcttctcctggttacagtatgagattgcaaaggtcatttggtgcctgcaccctaaaaacaagaagagattaaagtcacaagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaactgcaacaacttttgcctgtggaagcagtatgcacatctggagtggttgcttggcaacacagaggatgctagaaaagtttttgacacagcactcggcatggcaggaagcagagaactgaaagactctgacctctgtgagctcagtctgctctatgctgagctggaggtggagctgtcgccagaagtgagaggggccgccacagcccgagctgttcacatattaaccaagctgactgagagcagcccctatgggccctacgctggacaggtgtcggctgttcgcattttgaaagcgcgaaaggcttacgagcacgcgctgcaggactgtttgggtgacagctgtgtctctgatccagctcccactgattcctgtagccgcctaattagcctggctaaatgcttcatgctcttccagtatttgaccatagggattgatgctgctgtgcggatatacgaacaggtgtttgcaaaactgaacagttctgttttcccagaaggctctggcgagggggacagtgccagctcccagagttggaccagtgttctcgaagccatcacactgatgcacacgagcctgctgagattccacatgaaagtgagtgtttacccgctggcccctctgcgagaggcactctcacaggctttaaagttgtatccaggcaaccaggttctttggaggtcctatgtacagattcagaataagtcccacagtgccagcaagaccaggagattttttgacacaatcaccaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaactgaggaagagactggtggaaaccgtccagaggttagacggtagagagatccacgccacaattcctgagaccggcttaatgcatcggatccaagccctgtttgaaaatgccatgcgcagcgacagtggcagccagtgccccttgctgtggaggatgtatttgaattttctggtttccttaggaaataaagaaagaagcaaaggtgtattctacaaagcacttcagaattgtccttgggcaaaggtgttgtacctggacgccgtggagtacttccccgatgagatgcaggagatcctggacctaatgactgagaaggagctccgggtgcgcctgccactggaggagctggagctgctgctggaggattagagagcagcggggaaacgggctgtggcttcgaggtcaagttgcccgccctgcggagctaggaggcacgagtggagaacgtgtgtgttaggagaacgcggcttttgaaatgttctttctcgatagtaataatgtgggctgccagcctctcacatcttgcacgctttttgggtgtgtaaatgacacaaaagctatttacatattatatatgtgaatatgtgtatatatgtacatagccagagagtcataccaagtggtcattaaaccgacgatgattgaggcgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]