GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-26 15:46:25, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_023731696            4744 bp    mRNA    linear   MAM 25-JAN-2018
DEFINITION  PREDICTED: Trichechus manatus latirostris NRDE-2, necessary for RNA
            interference, domain containing (LOC101358227), transcript variant
            X1, mRNA.
ACCESSION   XM_023731696
VERSION     XM_023731696.1
DBLINK      BioProject: PRJNA189960
KEYWORDS    RefSeq.
SOURCE      Trichechus manatus latirostris (Florida manatee)
  ORGANISM  Trichechus manatus latirostris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Afrotheria; Sirenia; Trichechidae; Trichechus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004443981.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Trichechus manatus latirostris
                                           Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4744
                     /organism="Trichechus manatus latirostris"
                     /mol_type="mRNA"
                     /isolate="Lorelei"
                     /sub_species="latirostris"
                     /db_xref="taxon:127582"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..4744
                     /gene="LOC101358227"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101358227"
     CDS             857..3976
                     /gene="LOC101358227"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X1"
                     /protein_id="XP_023587464.1"
                     /db_xref="GeneID:101358227"
                     /translation="
MTFPSRSGHKDRALGSKSQSHQTHSQTENAVLKAKVRSLTGRFGRILGILSCGWRLLLFRYKRKGDSCLGINPKKQCISWEGAPTEKKNSHKHVERYFTKKNVGLMSIDGVAVSSKTEPPSSEPASFIPVKDSDDVAPSVTTWLNPLGIYDLSTTQWLQGQGPGEQDSKPPDSQPDRENAGLKAKVEEFNRKIRENPQDTQLWMAFVAFQDEVMRKPGLYAIDEGEQEKRKRSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCMEFWEPATLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSVSKIHNLYGKCLSTLSSVKDGSILSHPVLPGTEEAMFALFLQQCHFLRQAGHSEKAISLFQAVIDFTFFQPDSVKDLPTKEQVEFFEPFWDSGEPRAGEKGARGWRAWMHQQERGGWIVVNPDEDDEEPEEDDQEIRDKTLPRWQIWLGAERSRDQRHWRPWRPDKSKKQTEEDCEDPERQVLFDDVGQSLIRLSSQDLRFQLVEAFLQFLGVPSGFVPPASCLYLAMDENNIFDPGLSEEKPLTCSTLSFSGVGRVGRMDRLGCQRWAQGHNREGEEFIRNVFHLVMPLFSGKEKSQLCFSWLRHETAKVIWCLHTKNKKKLKSQGKNCKKLAKNLLKEPENCSSLCLWKQYAHLEWLLGNTEDARQVFDTALSMAGARELKDAELCELSLLYAELEVELLSDLRGAAMSRAVHVLTRLTERSPYGPYTGQVLAVHILKARKAYERTLQDCLDESCVSDPVPTSSVNRLVSLAKCFMLFQYLTTGIDAAVRIYEQVFAKLKGSVSPAGSGLEHSGSPHGLASAMEAVTLMHTSLLRFHVKVSVYPLTPLREALSEALKWYPGNRVLWRSYVQIQSKSHSASKTRRFFDGITRSTKSLEPWLFAIEAEKMRKRLVETVQRVEGREIHATVPESGLTNRIKALFEHAIQSDSGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYMDAVEYFPDEMQEFLDLMTEKELRVRLPVEELELLLED"
     misc_feature    1418..2236
                     /gene="LOC101358227"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
tgtgttccctgtcagggcagtcagtggtggtagccccaaatgaagttttatcgatggtcctttatttcaggattaaaaaaaagaatctgagacctatatgttatcttcttaagaagggatggatagaagacagcactgataggaaagtgactggtctgtgagatcgatcacctaggtcgcaggtctcagtgtccttcaccaggaacagtgtaaaagagggagtgagcatttctgccttatctgtcacctagggttgtggtgatcaaatgacataatgtgtatgtgacagtacttcaatgacaaagctgcaggagaatataaattaccgagatctggaagacaggcataatcttaaattcatgagacattaacgaagagttgaagtgttgtagaaagaagtcaaaccaggcagaaaaagttaattgcgaatcttcatatttctctaaatagaaacaatttgaaggtaaggtgaatttggatatatgcagttaacttgcataacaagaagttaagtctgatgagccttcagtcattcagaggtagtgcacgtattccctcggtaacttgttttcttcttcaaatgtaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcttgggaaggggctcccacagaaaagaagaattcacacaagcatgttgaacgctattttacgaagaaaaatgtgggattgatgagcattgatggcgttgccgttagcagtaaaactgaacctccctcatcagagccggcctcatttataccagtgaaggattcggacgacgtggctccttctgtcaccacctggctgaaccctctggggatttatgacctttccatcacgcagtggtcacaaggacagggccctggggagcaagagtcaaagccaccagactcacagccagacagagaacgccgttctcaaggccaaggtgaggagtttaacaggaagattcgggagaatcctcgggatactcagctgtggatggcgtttgttacttttcagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcttgggaaggggctcccacagaaaagaagaattcacacaagcatgttgaacgctattttacgaagaaaaatgtgggattgatgagcattgatggcgttgccgttagcagtaaaactgaacctccctcatcagagccggcctcatttataccagtgaaggattcggacgacgtggctccttctgtcaccacctggctgaaccctctggggatttatgacctttccaccacgcagtggttacaaggacagggccctggggagcaagactcaaagccaccagactcacagccagacagagagaatgctggtctgaaggccaaggtggaggagttcaacaggaagattcgggagaatcctcaggatactcagctgtggatggcgtttgttgcttttcaggatgaggtcatgagaaagccgggcctgtatgccattgacgaaggagagcaggagaagcgaaagcggtccctgaagctcatcctggagaagaagctggccatcctggagcgggccatcgagagcaaccagagcagtgtcgacttgaaactcgccaagctgaagctctgcatggagttctgggagcccgccactctggtcaaagagtggcagaagctgatattcttgcaccccaacaatacagccctttggcagaaataccttctattttgccagagtcaatttagcaccttctctgtgtcaaaaattcacaatctttatggaaaatgcttgagtactttgtcttccgttaaggacggcagcatcttatctcaccctgtgttgcctggcaccgaggaggccatgtttgcactctttcttcagcagtgccactttctgcggcaggctggtcactcagagaaggccatctccttgttccaggctgtgattgacttcaccttcttccaacccgacagtgtgaaagatctgcctaccaaagaacaggtggaattctttgagcccttttgggacagcggtgagccccgggctggggagaagggggcccgaggctggagagcgtggatgcaccaacaggagcggggcggctggatcgttgtcaacccagatgaggatgacgaagagccagaagaggatgaccaggaaataagagataagaccctgcccagatggcagatctggctaggtgctgagcgttcccgagaccagaggcactggcgaccctggcgccctgataagagcaagaagcaaaccgaggaagactgtgaggatccagagaggcaggtgttgtttgatgacgttggacagtctctgatcagactctccagccaggatctccggtttcagctggtggaagccttcctgcagttcttgggtgtgccttctggctttgttcccccagcctcctgcctctatctggccatggatgagaacaacatctttgatcctgggctttctgaggaaaagccattgacttgttccaccctttcattctccggcgtgggccgtgtcggccgcatggaccgcttgggctgccagcgatgggcccagggtcacaaccgagagggcgaggagttcatccgcaatgtcttccacctggtgatgcctttgttttcaggcaaggaaaagtctcagctctgcttctcctggttacgacacgagactgcaaaggtcatttggtgtctgcacactaaaaacaagaagaaattaaagtcccaaggaaagaactgtaaaaaactagccaagaatctccttaaggagccagaaaactgcagcagtttgtgcctctggaagcagtatgcacacctggagtggctgctgggcaatacagaggacgccaggcaggtattcgatacagcgctcagcatggccggtgccagggagctgaaggatgccgagctctgcgagctcagtctgctatatgcagaactggaggtggagctactctcggacttgagaggggccgctatgtccagagctgtccacgtactaaccagactgaccgagaggagtccctacgggccctacaccggccaggtcttggccgttcacattctgaaggcccggaaggcttatgagcgcacactgcaggactgcttggatgagagctgtgtctcagacccagttcccaccagctccgttaaccgcctggtgagcttggccaaatgctttatgctcttccagtacttgaccacgggcattgatgctgctgtgcggatatacgagcaggtatttgcaaagctgaagggctctgtgtcccctgcaggctctggcctggagcacagcggcagcccccacggtctggccagcgccatggaggctgtcacactgatgcacacaagtttgctccggttccacgtgaaagttagcgtttaccccctgactccgctgcgagaggcactctccgaggctttgaagtggtatccgggcaaccgagttctttggaggtcgtatgttcagattcaaagcaagtcccacagtgccagcaagacccgaagattctttgatgggatcaccaggtccaccaaatccttggagccttggttgtttgcaattgaagctgagaaaatgaggaaaagactggtggaaactgttcagagggtagaaggtagagaaatacacgccacagttcctgagagcggcttaacaaatcgaatcaaagccctgtttgaacatgcaatccagagtgacagcggcagccagtgccccttgctgtggaggatgtacttgaactttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccctgggcaaaggtgttatacatggacgccgtggagtacttccctgatgagatgcaggagttcctggacctaatgactgagaaggagctccgggtgcgactgccggtggaggagctggagctcctgcttgaagattagcgactcagagggcagggcccgcgccaccaaggccaagtggcctgccctgccggagcctggacgagcaagggggagcttgggcggactgcggcatgtgtgtgtttgcacacacacatgctgagagacatatacttctgagattactctttctcgatcatttgtgtctgggttatcagtctcccacaccttgcacatttttagatgtgtaagtgacacaaaagctattgttttacatattatatatgtgtgtgtgtgtgtacatagatggataattgtgccaagtggtgattaaacctgtggtggtcgaagtgtgtgcgagttcttgtttgttctgccctccctctgcccggccagcaccagccctgctctagtgaacgtgtttcctcagcaggcctccttggtgggtctgccaagtcctctggggtcttgcagttgcaattggaaaggtctgagaccagtttggacttagaggtctggttactcaacactggggccttctccccaggcagttagtagataaccagtttcgccctcatcttcacataggggctggctctaccagcagagagttatttaaatcttgatgttccagcctgtatcaactgtgtccagagttcctcattattccctaagtccttctgctcaggtgatgcctacgtctgtgtgccaacggcatcacctgagagcctgttagaaatgcagaacctgcatctcggctcctaggtatctacccaaagaactgaaagcaggaactcagacagatacctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]