GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:19:20, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_023586884             570 bp    mRNA    linear   MAM 17-JAN-2018
DEFINITION  PREDICTED: Dasypus novemcinctus galectin-2-like (LOC111762579),
            mRNA.
ACCESSION   XM_023586884
VERSION     XM_023586884.1
DBLINK      BioProject: PRJNA196486
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Dasypus novemcinctus (nine-banded armadillo)
  ORGANISM  Dasypus novemcinctus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Xenarthra; Cingulata; Dasypodidae; Dasypus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004467667.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Dasypus novemcinctus Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 45% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..570
                     /organism="Dasypus novemcinctus"
                     /mol_type="mRNA"
                     /isolate="3-136"
                     /db_xref="taxon:9361"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA: National Hansen's Disease Programs at
                     Louisiana State University, School of Veterinary Medicine"
     gene            1..570
                     /gene="LOC111762579"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins"
                     /db_xref="GeneID:111762579"
     CDS             1..570
                     /gene="LOC111762579"
                     /codon_start=1
                     /product="galectin-2-like"
                     /protein_id="XP_023442652.1"
                     /db_xref="GeneID:111762579"
                     /translation="
MVFGPLPQSLAEAELRLQGAPKLGLHFNPRYDQSTIVLNSFDGGWGKELVVDHLCFARGSEITETFEVTNMPRIFGTSLKIKGKIAKDADCFAINLGEGPEKRGLHFNPRYDRSSILLNSFECGWGKELVVDHLGFAQGSEIKVIMTLDSDGFKVTLPDGHQISFPNRLGLSQVPYLRVEGGPVITLIG"
     misc_feature    <61..>207
                     /gene="LOC111762579"
                     /note="Galectin/galactose-binding lectin. This domain
                     exclusively binds beta-galactosides, such as lactose, and
                     does not require metal ions for activity. GLECT domains
                     occur as homodimers or tandemly repeated domains. They are
                     developmentally regulated and may...; Region: GLECT;
                     cl00071"
                     /db_xref="CDD:320744"
     misc_feature    226..546
                     /gene="LOC111762579"
                     /note="Galactoside-binding lectin; Region:
                     Gal-bind_lectin; smart00908"
                     /db_xref="CDD:214904"
     misc_feature    order(226..228,235..237,244..246,439..447,460..462,
                     466..468,475..477)
                     /gene="LOC111762579"
                     /note="putative alternate dimerization interface
                     [polypeptide binding]; other site"
                     /db_xref="CDD:238025"
     misc_feature    order(316..318,322..324,328..330,349..351,355..357,
                     373..375,382..384,388..390)
                     /gene="LOC111762579"
                     /note="sugar binding pocket [chemical binding]; other
                     site"
                     /db_xref="CDD:238025"
ORIGIN      
atggtgttcggccccctgccccagagcctagcagaggcagagctccgcctccagggggcgcctaagctgggcctgcacttcaaccctcgctacgaccagtccaccattgtcctcaactcgtttgacggcggatgggggaaggagcttgtggtagatcatctgtgctttgcgcgagggtcagagatcacggagacatttgaagttacaaatatgccccgtattttcgggacatccctgaagatcaagggcaaaattgccaaagatgctgattgctttgcgattaatctgggtgaagggcccgagaagcggggcctgcacttcaaccctcgctacgacaggtcctccattctcctcaactcatttgagtgcggatgggggaaggagcttgtggtagatcatctgggctttgcccaagggtcagagatcaaggtcataatgaccttggatagtgacggattcaaggtgacgctgccagacgggcaccagatcagcttccctaacaggctgggcctctcccaggtgccctacctgagagtggaggggggtcccgtcatcaccctcattgggtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]