GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-20 11:56:54, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_023501518            3647 bp    mRNA    linear   MAM 11-JAN-2018
DEFINITION  PREDICTED: Sarcophilus harrisii NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X3,
            mRNA.
ACCESSION   XM_023501518
VERSION     XM_023501518.1
DBLINK      BioProject: PRJNA167725
KEYWORDS    RefSeq.
SOURCE      Sarcophilus harrisii (Tasmanian devil)
  ORGANISM  Sarcophilus harrisii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sarcophilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003816537.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sarcophilus harrisii Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3647
                     /organism="Sarcophilus harrisii"
                     /mol_type="mRNA"
                     /isolate="Salem"
                     /db_xref="taxon:9305"
                     /chromosome="1"
                     /map="unlocalized"
                     /sex="female"
                     /country="Australia: Taronga Zoo, Sydney"
     gene            1..3647
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     1 sample with support for all annotated introns"
                     /db_xref="GeneID:100929271"
     CDS             34..3159
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X3"
                     /protein_id="XP_023357286.1"
                     /db_xref="GeneID:100929271"
                     /translation="
MKHILLLHSLSSQENNATDNSGSHLVWLDDIQTLTTETFRTDKKPDPANWEYKSLYRGDIARYKRKGNSCLGINPKKQRISWEGTSTEKKQLHKKFERYFSKKSMRSVSSDGAPVCSKAEVFSSDLSPFIPVKDSDDEVPSSTSTWVNPLGVYDKSTTLWLQGQGPSDQETKQPTSQKDSEEVILKAKVEEFNRKVRENPRDIQLWLEFVSFQDEVMKRPSLYTISEGEQESRRKSLKLILEKKLSILERAIESNQNSVELKLARLKLCTEFWEPSTLIKEWQKLIFLHPNNTSLWQKYLLFCQSQFSTFTVSKIHNLYGKCLSTLAAVQDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHTEKAISLFQAMIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVVIKPDEDEDEPEEDDQEIKNKTLPKWQIWLSVEHSREQRHWLPWRPDKTKKQTDEDCDDPERQVLFDDLGLSLIKLPSLDLKFQLIDSFLQFLGVPSSYNLPASCLYLAMDENGIFDDGISDEKPLTFFNPSFSGINCVGRMDKMNRQEHRMGHCKEGEEFIQNIFHLVLPLFSGKEKSHLCLSWLQYEIAKVTWCLQTKNKKRLKSQGKKCKKLAKNLLKEPDNRNNFCLWKAYAHLEWLLGNIEDARKVFDTAISMAGPEDLSSRLFDLSLLYAELEVELSGNLEGATTSRAIHILTKLTENGPYIPYTGQVLAMNILKARKAYEHMLQKHLNESSAPDPSSFNCSGHLVGMVGCFMLFQYLTIGVNAAMHIYKQVYERLKGSISSEFSRLSANIGAQNLTNALEAVTLMHANLLRYHMKVSVFPLNPLRETLSEALKLYPDNQVLWRSYIQIQNKSHNASKTRRFFDIIIRSSESLEPRLFAIQAEKMRKRLVEAVLREEAGEIHSTIPETGLSNRIKVLFENAVQSDNGSNCPLLWRMYLNFLVSLGNKERSKGVFYRALQHCPWAKVLYMDAMDYFPDQFQEILDLMTEKELRVRVPIEELELLLED"
     misc_feature    604..1320
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
gaccttcagtgatggggagctcactacctcctgatgaaacacattttacttttgcatagtttaagcagccaagaaaataatgccactgacaacagtggaagccaccttgtttggcttgatgacattcagaccctgacaacagaaactttcagaacagataagaaaccagatccagcaaactgggagtataaatccctttatcgtggagatatagcaagatacaagaggaagggaaactcttgccttggtattaaccccaaaaagcaacgtatatcttgggaaggtacctctacagaaaagaaacaattgcataagaaatttgaacgctacttttctaagaaaagcatgcgttcagtaagcagtgatggagctcctgtttgtagcaaagctgaagtattctcatctgatctcagcccattcatcccagtgaaagactctgatgatgaagttccatcttctacctcaacttgggtgaatcctttgggagtctatgataaatctacaacactctggttacaaggacagggtccttcagaccaagaaacaaagcaacctacatctcagaaagatagtgaagaagttattctaaaagctaaagtagaggaatttaacagaaaagtccgagagaatcctagggatattcaactgtggctggaatttgtgtcttttcaagatgaagtgatgaaaagaccaagcctatacaccatcagtgaaggagagcaagagtccagaagaaaatcactgaagctaattctggaaaagaaattgtccattttagaacgtgccattgaaagcaaccagaacagtgtggaactgaagcttgccaggctaaaactctgtacagaattctgggaaccatctactttgatcaaagagtggcagaaactgatttttttacaccccaataatacatccttatggcagaaatacctcttattttgccagagccaatttagcacctttacagtatccaaaattcacaatctgtatggaaaatgccttagcaccctggcagcagtacaagatgggagcatcttatctcatcctgcattgcctggaactgaagaagctatgttcgccctctttcttcagcagtgtcattttctcagacaagctggccacactgaaaaagcgatttctttgttccaagccatgattgactttaccttcttcaaacctgacagtgtgaaagatcttcctaccaggggacaggtggaattctttgaacctttttgggatagtggagaacctcgggttggagaaaagggagcaagaggctggcgagcctggatgcaccagcaagaaaggggtggctgggtcgttattaagcctgatgaggatgaagacgaacctgaggaggatgatcaagaaataaagaataaaactcttccaaagtggcagatctggctcagtgttgagcattcccgtgaacaaaggcactggctgccctggcgccctgacaaaaccaaaaaacaaactgacgaggattgtgatgacccagagagacaggtgttatttgatgatctaggcctatctctcataaaacttcctagtttggatctaaaatttcaactgattgattcatttctacaattcttgggagtcccttcaagctataatcttccagcttcatgcctctatcttgccatggatgaaaatggtattttcgatgatgggatttctgatgaaaaaccattgacttttttcaatccatcattttccgggattaattgcgtcggtcgcatggacaaaatgaacagacaggaacatcggatgggtcactgcaaagaaggcgaggagttcatacagaatatatttcatcttgtattgcccctattttcagggaaagaaaaatctcatctctgcctttcgtggttacagtatgaaattgctaaggtcacttggtgtctgcaaactaaaaacaagaagagactgaagtctcaagggaaaaaatgcaaaaaactagccaagaatctcctcaaggaacctgacaacagaaacaacttttgcctttggaaagcatatgcccacctagaatggttacttggcaacatagaagatgcaaggaaggtttttgacactgctattagcatggcagggccagaagacttaagttctagactctttgacttaagcttgctttatgctgaactagaagtagaactctcagggaacttggaaggggctactacatccagagcaattcatatattaactaaactgactgagaatggtccatacataccttatactggacaggtattagctatgaacattttgaaagcccgcaaagcatatgagcacatgctgcagaagcatttaaatgaaagttcagctcctgacccatcttcttttaattgttctggtcatttggttggcatggttggctgctttatgcttttccagtatttgaccataggagttaatgctgctatgcatatatataaacaagtgtatgaaagacttaaagggtccatttcatcagaattctcaaggctgagtgcaaatattggagcccaaaatttgaccaatgcccttgaagctgtcacactgatgcatgcaaatctactcaggtaccacatgaaagtgagtgtgttccctttgaatcctctgagagaaacgctttcagaggctttaaaattatatccggacaaccaggttctttggagatcgtatatacagatccaaaataaatcccataatgccagcaagacaagaagattctttgatatcattataaggtcttccgaatccctagagccacggctgtttgcaatccaagctgagaaaatgagaaaaaggctggtggaagctgttctgagagaagaagctggagaaatccattcaacaattcctgaaacaggtttatcaaatcgaatcaaagtcttatttgaaaatgcagttcagagtgataatggcagcaattgccccttgttatggaggatgtatttgaattttctggtttctctaggaaacaaagaacgaagcaaaggtgtattttacagagccctccagcactgtccttgggcaaaggtgttatatatggatgcaatggattatttccctgatcaattccaggaaatcctggatctgatgactgaaaaggaattaagagttcgggtaccaatagaagaactagagcttctcttagaagattaataatgagtggaacaagatgattaatggagttaagactgaggtttgacagtcctgtaatagctgtgggaatgtacaaattgggaaacttggactaggagtggaacatttttttcctttattttttaaggacttatttaaaattttaaggtttctgggccagtgtaatgtatttttaagtattcagatgtctctcacaacctccatgtgtttagaagatttatttacacagaatgagttattttatagatcatatatatgaatatgatgtacatatgtacagaaagacagacttgggaataaataaatcttttgtaattggttccctttaaagccaatgcttcatgtggttcattatcagcatgctaaatgtttcttcttagaggacttggagatcaagagccaagtatactcgcctccttcacctgaattagatgtgggttatgtatgattctggggctaaagatctaatcctattgtgaccatcatct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]