LOCUS       XM_023419556            1104 bp    mRNA    linear   VRT 26-DEC-2017
DEFINITION  PREDICTED: Seriola lalandi dorsalis testis- and ovary-specific PAZ
            domain-containing protein 1-like (LOC111664790), partial mRNA.
ACCESSION   XM_023419556
VERSION     XM_023419556.1
DBLINK      BioProject: PRJNA423295
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Seriola lalandi dorsalis
  ORGANISM  Seriola lalandi dorsalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Carangiformes; Carangidae; Seriola.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019472450.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Seriola lalandi dorsalis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 5% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1104
                     /organism="Seriola lalandi dorsalis"
                     /mol_type="mRNA"
                     /isolate="HSWRI2012SDOR001"
                     /sub_species="dorsalis"
                     /db_xref="taxon:1841481"
                     /chromosome="Unknown"
                     /tissue_type="heart"
                     /dev_stage="adult"
                     /ecotype="SW California"
     gene            <1..1104
                     /gene="LOC111664790"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 97% coverage of the annotated
                     genomic feature by RNAseq alignments, including 3 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:111664790"
     CDS             <1..590
                     /gene="LOC111664790"
                     /codon_start=3
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1-like"
                     /protein_id="XP_023275324.1"
                     /db_xref="GeneID:111664790"
                     /translation="

LVDISRYSPLFNSHLRVCVDRQILPVASDTVDFMLSQNVAVDHAVLQTLLHKLGKQNLWLRAREVFRHSLSVGYYPGVSAPPGFMALIVPWRLGEVELALAFEMFITVNATIILQLSETTTSCLSITLKRTESAESEYLTAGSRLLSAACIPQPKLIVHYTAVNSSQDQVFTLDISSARRWLRHNHLWANEVWMH"

ORIGIN      

acttggttgacatctccagatacagtcctctgtttaactcccatctacgagtgtgtgtggacagacagatccttcctgtagcctcggatacagtggacttcatgctctctcaaaacgtggcagttgaccacgccgtgctgcagacacttttgcacaaactgggcaagcaaaacctctggctccgtgcacgggaagtctttagacactctctgagtgtggggtactacccaggtgtgtctgctccccctggtttcatggcactgatcgtcccttggcgactgggagaggtggagctggctctcgcctttgagatgttcatcactgtcaacgcaacaatcattctgcaactttcagaaaccaccacttcctgccttagcatcactctcaaaaggactgaaagcgctgagagcgagtacctcacagctggtagccgcctcctctctgcagcttgcatccctcagcccaaattaattgttcactacacagcagttaactcctcacaggaccaagtgttcacacttgacatttcctctgctcgacgctggctccgccacaatcatttgtgggccaatgaggtatggatgcattgacccatacagttattcccctgcggtccctggaagtacttaactttactttcccttgagcctgcttattttccacagagaacagttgactctgggaaaacaaccaatgaaatcaggaaaatgaacacacatgcatttctgttggctgtatgtttatacactaacggtcatatttcaatttagcgtttgactaagaagcagaaatcagaagatcacctccaaagactgacgccagaactttacatgttttttgttgttaattccacgttgtttcctgagttgttttagctgatttgtcactcagtgtttgtgtgatttaatatttggaaaaaaatgtctgtcagggaacagagtccagcataatttagcaggattgatgttataagtataagactttgtttgcttaattgtaaataacatctgagtgtaaataggtatatatttataatggtgtttagcctttgacagcattatgttactgtattatagtagtgattgtcaaaacctcaattgttgc

//