2024-05-20 07:36:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_022980291 1330 bp mRNA linear INV 04-NOV-2017 DEFINITION PREDICTED: Spodoptera litura copper-transporting ATPase 1-like (LOC111363465), partial mRNA. ACCESSION XM_022980291 VERSION XM_022980291.1 DBLINK BioProject: PRJNA416314 KEYWORDS RefSeq. SOURCE Spodoptera litura ORGANISM Spodoptera litura Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata; Ditrysia; Noctuoidea; Noctuidae; Amphipyrinae; Spodoptera. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_019224876.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Spodoptera litura Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1330 /organism="Spodoptera litura" /mol_type="mRNA" /strain="Ishihara" /db_xref="taxon:69820" /chromosome="Unknown" /sex="male" /tissue_type="whole body" /dev_stage="moths" gene <1..>1330 /gene="LOC111363465" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 16 samples with support for all annotated introns" /db_xref="GeneID:111363465" CDS <1..>1330 /gene="LOC111363465" /codon_start=2 /product="copper-transporting ATPase 1-like" /protein_id="XP_022836059.1" /db_xref="GeneID:111363465" /translation="
ESSAELVAVRVPINGMTCMSCVRSIEGSVRELPGIAYVKVELSENAGYFRYEPRTISEEAIRSHIEDMGFEVPTDTTEHETRNLLPKEIPTDLLIDMSGTGEMDEQEVLLSVVGMTCQSCVNTIEGALRELSGVRSVSVRLSEGTARIRYVRGTTTARQLADTVYALGFSVTVLAVDGDQYTETTSQSKSEEGSGDGAKPPSPVKSRAQINGSPPVAEGETSRCTLEVRGMTCASCVAAIEKHVQKLYGVHSILVALLAAKAEVKYSPAKISAADIANCITELGFPSSVISDCDGSGQKDLHVAIKGMTCASCVNKIEKSVLKLTGVVSCTVALTTCKGKIKYNAEQIGPRTICEAINNLGFDASVVTPHNRGTTNYLEHKEEIKKWRNAFLISLLFGGPCMVAMAYFMAAMSRGHSARDMCCVLPGLSLDNLIMFLLSTPVQ"
misc_feature 32..217 /gene="LOC111363465" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(47..55,62..64) /gene="LOC111363465" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 329..517 /gene="LOC111363465" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(344..352,359..361) /gene="LOC111363465" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 674..865 /gene="LOC111363465" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(692..700,707..709) /gene="LOC111363465" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 908..1102 /gene="LOC111363465" /note="copper chaperone CopZ; Region: chaper_CopZ_Eh; NF033794" /db_xref="CDD:411374" misc_feature 914..>1330 /gene="LOC111363465" /note="Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217" /db_xref="CDD:225127" ORIGIN
agagtcgagcgcggagctggtggcggtccgagtgcctataaatggcatgacctgcatgtcctgcgtccgcagcatcgagggatccgtcagagagcttcctggcatcgcttatgttaaggtggaactatcagaaaacgcaggctacttcagatatgagccgcgaaccatctcggaggaggctatccggtctcatatagaagacatgggcttcgaggtgcccactgacaccacggaacacgaaaccagaaacctgttacccaaagagataccgactgacctcttaatcgacatgtctggcacgggcgagatggatgagcaggaggtcctgttgtcagtcgtcggcatgacctgccagtcctgtgtcaatactattgagggcgctctccgcgagctttcaggcgttagatcagtatcagtgcgtctatcagagggcacggcacggatccgatacgtccgcggtacgactacggcacgacaactcgccgataccgtgtatgctctcggattctctgttactgtgttagctgttgatggggatcagtacacagaaacgacttcacaaagcaagagcgaggaaggatcaggtgatggagcgaaaccaccttctccggtcaagagtagagcacaaattaatgggtccccgccagtagctgaaggtgaaacgtctcgctgtacgttagaagtccgcggcatgacgtgcgcctcctgtgtcgcagccatagagaaacatgttcagaagttgtatggtgttcactcaatcctagtagctcttctagcagctaaagcagaagtgaaatactctcccgcaaagatatcagcggcggacatcgccaactgtatcaccgaacttggcttcccatccagtgtgattagtgactgcgatggcagtggacagaaggatctacatgttgctataaaaggcatgacttgcgcgtcctgtgtcaacaaaatagagaagagtgttctgaaactaaccggagttgtatcctgtactgtagcattgactacttgcaaaggtaagataaaatacaacgccgagcagataggtccgcgcactatatgcgaagcgatcaacaacctcgggttcgatgccagcgtcgtgacaccgcataacagaggcactactaattatttggaacataaagaagaaataaagaaatggcggaacgcgttcctgatatctctgctgttcggcgggccgtgcatggtggccatggcgtacttcatggcggccatgtcgcgcggccacagcgcccgcgacatgtgctgcgtgctgccgggcctgagcctcgacaacttgatcatgttcctgctctccacgcccgtccag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]