LOCUS       XM_022502771            4360 bp    mRNA    linear   MAM 20-SEP-2017
DEFINITION  PREDICTED: Enhydra lutris kenyoni ATPase copper transporting beta
            (LOC111146971), transcript variant X5, mRNA.
ACCESSION   XM_022502771
VERSION     XM_022502771.1
DBLINK      BioProject: PRJNA407952
KEYWORDS    RefSeq.
SOURCE      Enhydra lutris kenyoni (northern sea otter)
  ORGANISM  Enhydra lutris kenyoni
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Musteloidea; Mustelidae; Lutrinae; Enhydra.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019154099.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Enhydra lutris kenyoni Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4360
                     /organism="Enhydra lutris kenyoni"
                     /mol_type="mRNA"
                     /isolate="GAN:26980312"
                     /sub_species="kenyoni"
                     /db_xref="taxon:391180"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..4360
                     /gene="LOC111146971"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 1 Protein, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:111146971"
     CDS             392..4330
                     /gene="LOC111146971"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X5"
                     /protein_id="XP_022358479.1"
                     /db_xref="GeneID:111146971"
                     /translation="

MKQSFAFDNVGYEGGLDTVDPPQTATGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVRYVPSILSLLQICRHIEDMGFEASVSEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGKLGKLQGVVRVRVSLSTQEAVITYQPYLIQPQDLRDHVSDMGFEAVIKNKVVPVSLGPIDIERLQSTNPKTPLASDNRSLNNSETLEHQGSHTVTLQLRVDGMHCTSCVLNIEENIGQLPGVQSVQVSLESRMAQVQYDPSHLTATALQRAIEALPPGNFKVSLPDGVAGNGTGRRSSNRVVPAPTQRPQVLGVCDTVVLAIAGMTCASCAQSIEGLISQREGVQRISVSVADGTGVVLYDPSVTNPEELRAAVEEMGFEASVISENYSTNHVGNHSAGNSTAPPTAGVPASVQEVAPRAGGLPKNHNSGSLSKPPQASTTVTPQKCFLQIAGMTCASCVSHIEKSLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDMGFEATVMEDYTGSDGDLELIITGMTCASCVHNIESRLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNSSAHHLDHKVEIKQWRKSFLCSLVFGIPVMGLMIYMLVPSHEPHEAMVLDRNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLKHGTANMDVLIVLATTIAYTYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIVREEQVPMELVQRGDIIKVVPGGKFPVDGKILEGNTMVDESLITGEAMPVTKKPGSIVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTHNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTDSLGYCTDFQAVPGCGIGCKVSSVEGILAHGESQQSKQAAPPSRAGSAPEEIDVTPQTFSVLIGNREWMRRNGLTISSDVSDAMANHELKGQTAVLVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGIKKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIHLNLVLALIYNLVGIPIAAGGSPR"

     misc_feature    473..664
                     /gene="LOC111146971"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(491..499,506..508)
                     /gene="LOC111146971"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    728..916
                     /gene="LOC111146971"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(746..754,761..763)
                     /gene="LOC111146971"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1070..1246
                     /gene="LOC111146971"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1088..1096,1103..1105)
                     /gene="LOC111146971"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1370..1576
                     /gene="LOC111146971"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1766..1954
                     /gene="LOC111146971"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1781..1789,1796..1798)
                     /gene="LOC111146971"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1991..2182
                     /gene="LOC111146971"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2009..2017,2024..2026)
                     /gene="LOC111146971"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2246..4318
                     /gene="LOC111146971"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3239..3241,3245..3247,4283..4285)
                     /gene="LOC111146971"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3371..3379,3581..3583,3734..3742,3830..3832,
                     3950..3958,4016..4018,4025..4027,4034..4036,4091..4093,
                     4100..4102)
                     /gene="LOC111146971"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

tcgattttccaggtgtagagttcacttccgcggcggctgcggcgttggggtcagcccagctccggagcaaggcgcggagctgacccgagcccggctcccgccacgccgcaccttccccggcggcggctggcgagccctgggatctgcatctgcggtccggctctgcgccgctagcccgccctccagtccttcgccgcacacgccggaggcagaagacccagtccgcagtgcactggcccgaggtgacctgcgggctctgggccgatcaccgaagaaattggctcccccgaaggaggttgcttgaacaaggaaagacattacagccagagaagaggccagtcggaaaatcttgtctaaactttctttgcccgctcgtgcccgggagccagcgatgaagcagagttttgcctttgacaatgtcggctacgaaggcggcctggacactgtggacccccctcagacggccactggcaccatcagcatttcgggcatgacttgccagtcatgtgtaaagtctattgagggcaggatttccagcctgaaaggcatcgtgagcattaaggtttccctggaacagggcagtgcgacggtgaggtatgtgccgtcaatcctgagcctgctgcagatttgccgtcacattgaggacatgggcttcgaggccagcgtctcagagggaaaggctgcctcctggccctcgaggtcctcgcctggcctcgaggctgtggtcaagcttcgggtggaaggcatgacctgccagtcctgcgtcagctccattgaaggcaagctcgggaaactgcagggagtagtgagagtccgagtgtccctcagcacccaggaggcagtcattacttaccagccttacctgattcagccccaggacctcagggaccacgtcagcgacatgggctttgaagctgtcatcaagaacaaagtggtgcctgtaagcctgggacccattgatatcgagcgcttacagagcaccaacccaaagacccctttggcttctgataaccggtccctcaataactctgagaccttggagcaccaagggagccacacagtcaccctgcaactgagagtagatggaatgcactgtacgtcttgtgtcctgaatattgaagaaaacataggccagctccccggggttcaaagtgttcaagtgtccttggagagcagaatggcccaagtacagtatgacccttctcacctcaccgccactgccctgcagagggccatcgaagcgcttccacctgggaacttcaaagtctctcttcctgatggtgtggcaggaaatgggacaggtcgcaggtcttccaaccgtgtcgtccccgcccccacgcagagaccccaggtgttgggggtgtgcgatactgtggtgctcgccattgctggcatgacctgtgcgtcctgtgctcagtccatcgaaggcctcatctcccaaagggaaggggtacagcggatatcggtctctgtggctgatgggaccggcgtggtgctctatgatccgtctgttactaatccggaagaactccgagctgctgttgaagaaatgggatttgaggcttcagtcatttctgaaaactattccaccaaccatgttggaaaccacagtgcagggaattccacagcgccccccacagctggcgttcctgcgtctgtacaggaagtggctccccgtgccggggggctccctaaaaaccacaactctggctccttgtccaagcccccacaggcctctaccacagtgactccccagaagtgctttctacagatcgcaggcatgacctgtgcatcctgtgtgtcccacatagagaagagcctgcagaaggaagcaggtattctgtcggtgctggttgccctcatggctgggaaggcagaggtcaagtataacccagaagtcatccagcccctggagatagctcagctcatccaggacatgggctttgaggcgacagtaatggaagactacacaggctctgatggcgacctcgaactcatcatcacggggatgacctgcgcgtcctgtgttcacaacattgagtccagactcacaaggacaaacggcatcacctacgcctctgtggcccttgccaccagcaaagcccatgtgaaatttgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaactccagcgcgcatcacttggaccacaaggtggaaataaagcagtggaggaagtctttcctgtgcagcctagtgttcggcatccccgtcatgggcctcatgatctacatgctggtgcccagccatgagccccatgaggccatggtgctggaccgcaacatcattccgggactgtccatcctcaatctcatcttctttatcttgtgtacctttgtccagctcctcggcgggtggtacttctacgtccaggcctacaggtctctgaagcatgggacggccaacatggacgtgctcatcgtgctggccaccaccatcgcctacacctactcgctcgtcatcttagtggtggccgtagctgagaaggcggagaggagccccgtgaccttcttcgataccccccccatgctctttgtgttcattgccctggggcggtggctagaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccaccgttgtgacccttggtgaggacaacttgattgtcagggaggagcaggtgcccatggagctggtgcagcggggcgacatcatcaaggttgtccccggggggaagttcccagtggatgggaaaatcctggaaggcaacaccatggtggacgagtccctcatcacaggagaagccatgcctgtcacgaagaaacccggaagcatagtgattgctgggtctataaatgcacatggctctgtactcgttaatgccactcacgtgggcaatgacaccacgttggctcagatcgtgaaattggtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtgggtattttgtcccatttatcatcatcatttcaacgctgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcccacccacaacaagcacatctcccagacagaggtgatcatccggtttgcgttccagacgtccatcacggtgctgtgtatcgcctgcccctgctccctgggcctggccacgcccacggcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggaaatggcccacaagataaagaccgtgatgtttgacaaaactggcaccatcacccatggggtccccaaagtcatgagggtcctcctgctcgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccttgggtgtggcagtcaccaagtactgtaaagaggaattgggaactgactccctgggatactgcacggacttccaagcagtgcccggctgtggcatcggctgcaaagtcagtagtgtggagggcatcctggcccacggcgagagccagcagagcaaacaggcggctcccccgagcagggctggcagcgctcccgaggaaatagacgtgaccccccagaccttctctgtgctcatcgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacgtcagtgacgcgatggcgaatcatgagctgaaaggccagacggccgtcctggtggccattgacggcgtgctctgtgccatgatcgccatcgccgacgcggtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaagacggccagagccatcgccacccaggttggtatcaagaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaagttgccatggtaggagacggggttaacgactcgccggccttggcccaggccgatgtgggcattgccatcgggacgggcacggatgtcgccatcgaggccgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctctccaagaggaccgtctggagaatacacctcaacctggtgctggcgttgatttataacctggtcggaatacccatcgcggcagggggcagcccgaggtgaggaccttctccaggctatggtgtgagtgtt

//