GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:19:28, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_021531927            5690 bp    mRNA    linear   VRT 05-NOV-2019
DEFINITION  PREDICTED: Lonchura striata domestica NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), mRNA.
ACCESSION   XM_021531927
VERSION     XM_021531927.2
DBLINK      BioProject: PRJNA391487
KEYWORDS    RefSeq.
SOURCE      Lonchura striata domestica (Bengalese finch)
  ORGANISM  Lonchura striata domestica
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Estrildidae; Estrildinae; Lonchura.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_042571.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 5, 2019 this sequence version replaced XM_021531927.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Lonchura striata domestica
                                           Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5690
                     /organism="Lonchura striata domestica"
                     /mol_type="mRNA"
                     /isolate="Mets1"
                     /sub_species="domestica"
                     /db_xref="taxon:299123"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..5690
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 ESTs, 1 Protein, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 7 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:110471357"
     CDS             323..3826
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_021387602.1"
                     /db_xref="GeneID:110471357"
                     /translation="
MALFPAFAGAGPPGEPPAGSSEGSTRELDWLSNPSFSAEDALLLHQRTAEVANLIPEKSPLIRTSSRSELSEESDTDESLKQTSKKRKKKKKKHHHNKKTKKKTKGDSSSSESEVDTKHIKDKGSGKSSEKETAANLGKKASNVTSSHSIWLDDIQAPSADTFRIDKKPDPANWAYKSLYRGDIARYKRKGESCLGIDAKKQCITWESSASKRKQAQSRPERYFTKNNVKMLNTDGILVCNKSSPSDPPAFIPVSQVETDDSSDTTEVNPLGIYDPSTTVWLQGKGKSADNESVNTQQTIQERGINMNSILMTKVEEYNKKVRENPRDINAWMEFISFQDELMRGPSLYASKGEQELRRKSLKLILEKKLAILERAIESNPSNVDLKLARLKLCTEFWEPPAVIKEWQKLIFLHPNNPEMWKKYLLFCQSQFTTFSVSKINSLYGKCLTTLAAVQDGSMVSHPLLPGTEEAMLAIFIQQCHFLRQAGHSEKAVSLFQALIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRIGEKGARGWKAWMHQQEKGGWVVLKPDDEDEEEIDEDQEIKDKTLPKWHIWLNVEYSREARHWLPWRPDKTKKETEEDCEDPERQVLFDDLGPSLIRLSNPKLQHQLLYSFLQFLGVPCTSKLFPSSLYIAMDENSIFDSVLYDDKPLTSVDFPLSGFNSIGHMDMMSRGRHQIGHYKEGEEFIQNVFHVLFQIFTGKEKSNLAICWLQYEISKVIQCLQAKKKKKLKAQGRKSKKLAKNFLKAPDNRNNLSLWKLYAYLEWLLGNTDDSRKVFDTALCTAGTGGLKSAQLCSLSLLYAQLEVELLESTEGAVMSRAVHILTKLTENGPYVPYSGQVLPVNVLKARKIYEHALQDYLSKTAVSDQDLVNDADQLVNLVGCYALFQYLTVGIDAAVLIYTQASEKLEVSCSQKCENTGENFGIQNFPTALEAVTLLHTNLLRFHMKISVYPLNPLREALTEALKRYPSNQSLWRSYIHIQRKSHSASKARRFFDSVTRSTNSLEPWLFAIQAEQMRKKLAEKVQRADVGEIHCTIPETGLTNRIVALFEHAVQSENGTHCPLLWRMYLNFMASLGKKEKSKGLFYKALQNCPWAKVLYMDAVEYFPEDLQETLDLMTEKELRVRVPMEELDLLLEI"
     misc_feature    1271..1984
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
ccgagtgttccgtcccggcgagcttcatgagggatgggggtggtgggaaactgctctggaaactgcatcccgcctcttcccgcagcagctccctgctccagtcccgcagtgcggcggcggagggtgcacgataagcggggtcccacagaaagccgcgaccccagcgccgagccttcctccccagcgccgagccttccccccccagcgccgagccttccttcccagcgccgagccttcctccccagccgccatcttggcgccgggcggaagaactaccggtcccggcgcgctcggcgtgcggcgccatcttgccgccggagacatggcgctgttccccgccttcgccggggccggcccgcccggggagccccccgcgggcagctccgagggctccacgagagagttagactggcttagtaacccaagcttctctgcagaagatgcactcttactgcaccagcgcactgcagaagttgccaatctcattcctgaaaaatcaccattaataaggacttcttcgagatctgagttgtcagaggagagtgatacagatgagagtctgaaacagacaagtaagaaaaggaaaaagaaaaagaaaaagcatcaccacaataagaagacaaaaaagaaaaccaaaggggattccagtagcagcgaatcagaggtggacactaagcacatcaaggacaaaggaagtggcaaaagtagtgaaaaggaaacagcagcaaatctaggtaagaaagcatcaaatgttaccagcagtcattctatttggctggatgatatccaggcccccagcgcagacaccttccggatagacaagaagccagaccctgcaaactgggcctacaaatccttgtatcgtggggacatagcaaggtataaaaggaaaggagagtcctgtcttggcatagatgcaaagaaacagtgcataacctgggagagttctgcatcaaaaaggaagcaagcacagagtcgacctgagcgctactttacaaagaacaatgtgaagatgctgaacacagatgggattcttgtttgtaataaaagttctccatctgatccacctgcttttataccagtttcccaagtggaaactgatgattcttctgacacaacagaagtaaatcctcttgggatttatgatccgtcaaccacagtgtggctacaaggaaaaggcaagagtgcagacaatgagtctgtaaatacacagcaaacaattcaagagcgtgggataaacatgaactccattctaatgacaaaagtggaagaatataacaagaaagttagagaaaacccaagagatattaatgcttggatggaatttatttcctttcaggatgaattaatgagaggacctagcctttatgccagtaagggagagcaggaattaaggagaaaatcactcaagttaatcttggaaaagaaactggccattttagagagggcaattgaaagcaatccaagtaatgttgatctgaaacttgctaggctgaagctttgcacagaattctgggaaccaccagctgtgatcaaagaatggcagaagctgatttttttacatcccaataatccagagatgtggaagaaataccttctattctgtcaaagtcagttcactaccttttctgtttcaaagatcaacagtctctatggaaaatgtttgacaacactggcagctgtacaggatggcagcatggtatcccatcctctgctgcctggcactgaagaagctatgctggctatatttattcagcaatgccactttctgcgacaggctggccattctgagaaagcagtgtctttgtttcaggctcttattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaggggacaggtggaattctttgaacccttttgggatagtggagaaccacgaattggagaaaaaggagcaagaggctggaaagcatggatgcaccaacaagaaaagggtggctgggttgttcttaagcctgatgatgaggatgaggaagaaatagatgaggatcaagaaataaaagataaaactcttcccaagtggcatatttggttgaatgttgaatattcccgtgaggcaaggcactggttaccttggaggccagacaaaactaagaaggaaactgaagaagattgtgaagatccggaaagacaggtgttatttgatgatcttggaccatctttaatccgtctttctaatccaaagcttcaacatcaactattgtactcttttttgcaatttctgggagttccatgtacaagtaaactctttccttccagtctctatattgccatggatgaaaatagcatctttgacagtgtgctttatgatgataaaccactgacttctgttgattttccactttctggattcaacagtattggtcatatggatatgatgtcacgaggcagacatcagataggccactacaaagaaggagaggagttcatacagaatgtcttccatgttctgttccagatatttacaggaaaggaaaaatctaacctggccatttgttggctacagtatgaaatatctaaggtaattcagtgtctccaagctaaaaagaaaaagaagctaaaagcacaggggaggaagagtaaaaagttggccaagaattttcttaaagcacctgacaaccgaaacaacctttctctctggaaactctatgcctacctagagtggctgcttggtaacacagatgattccaggaaggtgtttgacacagctctttgcacagcagggacaggaggattgaaaagtgctcagctctgcagcctcagcctgctgtatgctcagctggaagtggaactgctggaaagtacagaaggagctgtcatgtcacgtgctgttcatatattgaccaaattgactgaaaatggaccatatgtgccctacagtggacaagtgctacctgtgaatgtcttgaaagctcgtaaaatatatgagcatgcactgcaagattatttaagtaaaacagcagtatctgatcaggatctggtcaatgatgctgatcagctggttaacctggttggttgttatgcactgtttcagtatttgactgttgggattgatgctgcagtattaatatatacgcaggcttcagaaaaacttgaagtttcttgttcacagaaatgtgaaaatacaggagagaattttggcattcaaaattttcccactgctcttgaagctgtcacactgctgcatacaaatttactgagattccacatgaaaattagtgtttatcctttgaatcccctgcgagaggcactgacagaggctctgaaacggtatcctagcaaccagtctctttggaggtcatacatccatatccaaaggaagtctcacagtgcaagcaaagcacgaagattttttgatagtgtcacaaggtctactaactctttagagccatggctgtttgcaatccaagcagagcagatgagaaaaaaactcgcagagaaggtccagagggcagatgttggtgaaatacattgtactattcctgaaactggattaacaaatcggattgtagctctgtttgaacatgcagttcagagtgaaaatggtacccactgtccactgctatggagaatgtacttgaactttatggcttcactaggaaaaaaagaaaagagtaaaggattgttttataaagcccttcaaaactgtccttgggcaaaggtactctacatggatgcagtagagtatttccctgaagatctgcaagagacacttgatctaatgactgaaaaagaattgagagtgcgggtgcctatggaagagctggatctactactagagatttaaaagaagactgtagcggagtggaggaagtacagaagctgcttccaaagctaacaattatttccattttcatacaggaactctgttgggacttgggtactatgtacttgatattttttgttgttaagtattttatataaattcctatcaaaatggagttctactacctgcaagtattctggaatcaaggactgcattttgcccacagtaatggatccatttctccgaagtattgctggctcccacagaaggataccctctttaaatagcctcctgttggaagttgcctgcattttttattctgttgtttgaaattacattccctagggttcagtagaggttcagtacatgccgactatggcttggtgagcagcataaaaaataaacatctgccaaatggatgctccactgtcctccagttggcagacttcagtaatttccttcagcatggtatggctgtacatatacaactgccaagtcaaagagccgttacatctgtacatatactgtgagtaaaagctaaattattgtttgagcaggcacctattttggtatgttttgacagatgaccatttaaatgtaaatctttctgaaaaatgtacctgaatatttgagaattcaaaagtaatttgttttttatgtattaatttaatagaactgagtgtattaaaaatgaaaacacatccataatgtatctctaagcagctcacttctaaacaaatttttgtaattgatcactggctttgactcaaatccaggcaattgttgtaagagaactagaggtgtgatctgtatttgattctcatcaagaaggcatagtcttctatgattatttaaaaagtagcttatattccaagaggcttttagcaagctcctagagaagttataggaaatatggtaacaatttaaagatacagttacgtattttggaaaacagaacatgctgaaatggaaaggattgtttagcatccctacttttgtgactcaaggactcagaaactggattttcatctgcaacaagtatatacctgcagccacagaatacccaaaattgcttcagagatttttcatgagaaaactaattgaaagatcatctggtccaaccttttgtgggacagggagcctggatgagattaacaagctctctctgcagtcacatttgaaaacttcgggtgatggcagcaacaacttctctatctatcacttttctgttcttccatgcatcctgtcccaagtcctttcctttgcagtttctcccaaagcagcacttggactgcttccttccttttgatggtcagaagcttcctagatcaggtcctgccttttaatccagtccccaggagattttctgtccttgtggggaatatacttgctgttcactttctcctggtatttattacttttgtcttgtcaagttcagaaactctggcaaaagtggcagcagttaaattctgctgcaaaagctaagagctgaattttcaaatgtgtttttcagttcctgtggtggcattcagggtaccagaacagagtccttgggttcatttaatgcagtgcagctgttccttcagcgatctgaacccatctctttgtggctgttgctttgagccaacagtaacagccatgtccttaataaaaagtgccttgcttgccatgcatgtcataaagctcttcagcccctcaagcaacagtgaaatcaactgccatgattagaaagtgctaaaaaatcccctagctgtttgtgacctttccaaggagacagatctcctaaggtttctaagaatgggtaataaaacttgtttttctagctccagatgaaaaacaattctatttcaggatttctgtcatccagattaaataaaggactcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]