GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-02 14:47:03, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_021257375            1733 bp    mRNA    linear   ROD 23-MAY-2017
DEFINITION  PREDICTED: Heterocephalus glaber testis and ovary specific PAZ
            domain containing 1 (Topaz1), transcript variant X6, mRNA.
ACCESSION   XM_021257375
VERSION     XM_021257375.1
DBLINK      BioProject: PRJNA197330
KEYWORDS    RefSeq.
SOURCE      Heterocephalus glaber (naked mole-rat)
  ORGANISM  Heterocephalus glaber
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Bathyergidae; Heterocephalus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004624730.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Heterocephalus glaber Annotation
                                           Release 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1733
                     /organism="Heterocephalus glaber"
                     /mol_type="mRNA"
                     /isolate="NMR 29"
                     /db_xref="taxon:10181"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..1733
                     /gene="Topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 3 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:110348889"
     CDS             520..1677
                     /gene="Topaz1"
                     /codon_start=1
                     /product="testis- and ovary-specific PAZ domain-containing
                     protein 1 isoform X5"
                     /protein_id="XP_021113034.1"
                     /db_xref="GeneID:110348889"
                     /translation="
MACEKFADFQIFCACIAETLTKDYKEENPAVPFCEFAETVNEDPQNSEVDKTLLGRIGISAIYFYHKLLQWSKGRKVLDKLYELKIHFTSLKGLTGPAKLAPRCQIVNVAAEIFLKSGSLDGAIWVLRESEWIISTPLWPCDRLDVLNRHNLLCTIAHEILPKSLYRQTFEVLQNLPGFQNSQETVEVSQHSLLFNKLLDACIESNSLGMSSSVAEFMVSRKIPIDFSFLRRLITSLGRSCLWLKARTHYKSALSLGCYPPLEGNLYRKLLLVPCYLSEIEMLLAIEIFLVSNASSIQSPGNSTQVLQIVLKRCEENKSRSEDDYQAAVERLILAARISDPKLFIKHVTVNVNKEQVYSLEHCSALKWLKENMKWAGKVWLFSNH"
     misc_feature    520..984
                     /gene="Topaz1"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:464250"
ORIGIN      
ttgagggccttaacatctttgcgtgggttgcctggttttgtctttttcctccctcttttggattcttggtttcttcatctttgaaggtttataatagttgttaggcctttgtcagtggtatacatatattacaattctttccatcttgacccttatttggacattgtgatgggttttgccgtgcaaaaacttctgtttgtatgcaacctaatgtttcaatctttttttttcaattgccctcagttttgagtcatttttttttattgcctctggattttaagttgtaattttccctcccccaaggttttagaggaaattattcacggttccttcaactactcccatgatgttattgttggagttagattcctcatctttttggagtttcttcttaggttacaggtggggcagttcacaaagaactggaagcatgatttagattcagccttgaatgaagtagagaattgtaaagaaaaaggtgactggaccaaattgggaaatttatacattaatgttaaaatggcctgtgaaaagtttgcagatttccaaatattttgcgcttgtattgctgaaacactcacaaaagactataaagaagaaaacccagctgttcctttctgtgaatttgctgagacagttaacgaagatccacagaatagtgaagtagataaaactttgctgggaagaatcggaatcagtgctatatacttctatcacaagctgttgcagtggtccaagggaaggaaggtcttggataagctgtatgagttaaaaatacattttacaagtttaaaaggactcacagggcctgcaaaattagcaccaagatgtcaaattgtgaacgtcgcagcagaaatttttctaaaaagtggaagcctagatggtgccatttgggtattgagggaatcagaatggataatcagtacgccactttggccttgtgatagactggatgtgcttaatcgacataatttgctctgtacaattgcacatgaaatcttacccaagagcctttacagacagacatttgaagttttacagaacctaccaggttttcaaaattctcaagaaactgtggaggtctcacagcatagcttgctttttaataagctcttagatgcctgcatagaaagcaacagtcttggcatgtcatcctcggtggctgaattcatggtttccaggaagatccctattgatttttcctttctgagaagattaataacttctttaggaaggagttgcttatggctcaaagccagaacccactacaaaagtgctctttctctgggttgctacccaccattggagggaaacttataccgaaaacttctacttgttccttgttatttatctgagattgaaatgcttttagctattgaaatcttcttggtatctaatgctagtagtattcagagtccgggaaattctacacaggtgcttcagatagttctgaaaagatgtgaagaaaacaaatctcggagcgaggatgattatcaagctgcagtcgaaaggttgattttggctgctcgcatatcggacccaaagctgttcattaagcacgtgactgtcaacgttaataaggagcaggtttacagcttggaacactgttctgccctgaagtggctgaaagagaatatgaagtgggccggaaaggtttggcttttcagtaaccattagttaataaaggcttttttttaagttcaaataatcattgttgacagtaaaagacaata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]