LOCUS       XM_020735293            1512 bp    mRNA    linear   PLN 10-APR-2017
DEFINITION  PREDICTED: Phalaenopsis equestris probable pectate lyase 12
            (LOC110031868), mRNA.
ACCESSION   XM_020735293
VERSION     XM_020735293.1
DBLINK      BioProject: PRJNA382149
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Phalaenopsis equestris
  ORGANISM  Phalaenopsis equestris
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Asparagales; Orchidaceae;
            Epidendroideae; Vandeae; Aeridinae; Phalaenopsis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018165295.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Phalaenopsis equestris Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 38% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1512
                     /organism="Phalaenopsis equestris"
                     /mol_type="mRNA"
                     /db_xref="taxon:78828"
                     /chromosome="Unknown"
     gene            1..1512
                     /gene="LOC110031868"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 72 Proteins, and 63% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:110031868"
     CDS             136..1512
                     /gene="LOC110031868"
                     /codon_start=1
                     /product="probable pectate lyase 12"
                     /protein_id="XP_020590952.1"
                     /db_xref="GeneID:110031868"
                     /translation="

MQTSPLWIIFAFDMYIRLNQELLVNSFKTLDGRGANIHIAGGACITLQFVSNVIIHNLHIHDCVPSGNAIVRSSPTHAGFRGRSDGDGISIYAGRDIWIDHCDLSNCADGLIDAIMGSTAITISNCYFSRHNEVMLMGHRDDYLPDSGMQITIAFNRFGEKLVQRMPRCRRGYFHIVNNDYTEWEMYAIGGSANPTINSQGNRYRAPPDPNAKEVTKRIETDEEEWKEWNWRTEGDMLVNGAYFVPSGEGSAATYEKASSLDPKSAQFIDQLTCNAGVLGSPRIEGRACKFPGFVGQVTKRIETDEEEWKEWNWRTEGDMLVNGAYFVPSGEGSAATYEKASSLDPKSAQFIDQLTCNAGVLGSPRYPFKGLDDCLVIRTQSHLKSLYTSMRRLMTLEITPPFAIAISRARTRLPALDVRETCSRLPQFRESAPDPTSDREESRPFARNHSRLLYFGK"

     misc_feature    172..759
                     /gene="LOC110031868"
                     /note="Amb_all domain; Region: Amb_all; smart00656"
                     /db_xref="CDD:214765"
ORIGIN      

ttcctcctcgccgattgctccatcggcttcggccgctccgctctcggcggcaaaaacggcctcatctacaccgtcaccgattcctccgactccgatcccgccaaccccctccccggcactctccgccacgccgccatgcaaacctcacccctctggatcatcttcgccttcgacatgtacattcgcctcaaccaagaactcctcgtcaacagcttcaaaaccttagacggacgcggcgcaaacatccacatcgcgggcggagcctgcatcaccctccaattcgtctccaatgtcatcatccacaaccttcacatccacgattgcgtcccctccggaaacgccatcgtccgatcctctccaacccacgccggattccgcggcagatcggatggcgatggaatctcgatctacgccggacgcgacatatggatcgatcattgcgatctctccaactgcgccgacgggcttattgatgcaataatgggatcgacggcgatcacgatttccaattgctacttctcgaggcacaatgaggtcatgcttatgggtcacagagacgattacctgccggattcggggatgcagatcaccatcgccttcaatcgatttggggagaaactggttcagaggatgccgaggtgcaggcgtgggtattttcatattgtgaacaatgattacacggaatgggagatgtacgccattggtggcagcgccaatcccaccattaatagccaggggaatcgatacagagctccccctgatccaaatgccaaggaggtgacgaagagaatagagacggatgaggaagagtggaaggagtggaattggaggacggagggagacatgctggtcaacggcgcttacttcgtgccgtcgggagagggctcggcggcgacgtacgagaaagcctccagcctggaccccaagtccgctcagttcatcgaccagctcacctgcaacgccggcgtgctcggtagccccagaattgaggggcgtgcatgtaaatttcccggctttgttgggcaggtgacgaagagaatagagacggatgaggaagagtggaaggagtggaattggaggacggagggagacatgctggtcaacggcgcttacttcgtgccgtcgggagagggctcggcggcgacgtacgagaaagcctccagcctggaccccaagtccgctcagttcatcgaccagctcacctgcaacgccggcgtgctcggtagccccagatatccgttcaaaggacttgatgattgtttggtgataaggactcagagccatctgaagagcctttatacttctatgaggcgtctgatgacactggagatcactcccccattcgcgatcgcgatctcccgcgcccgaacccgccttcccgctcttgatgttcgcgaaacctgttcccgcctccctcagtttcgtgaatcggcccccgatcccacttctgatcgcgaagagtcgcgtcccttcgctagaaaccactctcgcctcctctatttcgggaagtga

//