GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-12 22:19:50, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_020539519            1033 bp    mRNA    linear   PLN 20-FEB-2025
DEFINITION  PREDICTED: Zea mays protein argonaute 1B (LOC103630173), mRNA.
ACCESSION   XM_020539519
VERSION     XM_020539519.2
DBLINK      BioProject: PRJNA655717
KEYWORDS    RefSeq.
SOURCE      Zea mays
  ORGANISM  Zea mays
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
            Zea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_050101.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 31, 2020 this sequence version replaced XM_020539519.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902167145.1-RS_2025_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/14/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1033
                     /organism="Zea mays"
                     /mol_type="mRNA"
                     /cultivar="B73"
                     /db_xref="taxon:4577"
                     /chromosome="6"
     gene            1..1033
                     /gene="LOC103630173"
                     /note="protein argonaute 1B; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 4 long
                     SRA reads, and 89% coverage of the annotated genomic
                     feature by RNAseq alignments, including 9 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:103630173"
     CDS             254..850
                     /gene="LOC103630173"
                     /codon_start=1
                     /product="protein argonaute 1B"
                     /protein_id="XP_020395108.1"
                     /db_xref="GeneID:103630173"
                     /translation="
MGLSLNIDMSSTAFIEPLPMIDFVAQLLNRDILVRPLSDSDRVKIKKTLRGVKVEVTHRGNMRRKYRISGLTSQATRELSFPVDDRGTVKTVVQYFMETYGFSIQHTTLPCLQVGNQQRPNYLPMEVCKIVEGQRYSKRLNEKQITSLLKVTCQRPQERELDILQDSGSHQVTPPHHDDFADKCLNSSGGATNNNLMS"
     misc_feature    302..646
                     /gene="LOC103630173"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(449..451,494..496,527..529,539..541,593..595,
                     614..616,620..622)
                     /gene="LOC103630173"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      
agtatttaaggtggtgatcaaatttgcggcccgtgctgatctccaccatctggctatgtttctagctggaaggcaagcagatgcccctcaggaagctcttcaagtgcttgacattgtactacgtgaattgcctaccgcgaggtattctcctgttggtaggtcattttactctcccaacttagggagacgtcaaaaacttggtgagggataggaaagttggcgtggtttttaccaaagcataaggccgacaaagatgggcctttcactgaatattgatatgtcctctactgcatttatcgagcctctccctatgatcgattttgttgctcagcttcttaacagagatatcttagttagaccattatctgattctgatcgcgtgaagattaaaaaaaccctaagaggtgtgaaggttgaggtgactcacaggggaaacatgcgcagaaaatatcgcatttctggcctcacctcacaagcaacaagagagctatcattccctgttgatgatcgtggtactgtgaagactgtggtgcaatacttcatggagacttatggttttagtatccagcacaccactttaccatgcttgcaagtgggcaatcaacaaagaccaaattatctgcctatggaggtttgcaagattgttgaaggacagcgttactcaaagcgactcaatgagaaacaaatcacttctctactgaaagtgacctgccagcgccctcaagagcgtgagctagacatcttacaggattccggctctcatcaagtgactcctccccatcacgatgactttgcggacaaatgtctcaattctagtggtggagctacgaacaacaatctgatgtcctgattgagagcgatagagctaatgtttgaacttgtgtgtttgaacttgtgaactaaaaatgtgaactatagatgtgaacttatgtgaatttgtgaacttatgcatttggacttatgtgaatttgtgaacttatgtatttggacttgtgtgaatttgtgatatgaacatatatccatgtgtttgaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]