2024-03-29 23:34:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_020284849 1081 bp mRNA linear PRI 24-FEB-2017 DEFINITION PREDICTED: Microcebus murinus claudin 34 (CLDN34), mRNA. ACCESSION XM_020284849 VERSION XM_020284849.1 DBLINK BioProject: PRJNA285159 KEYWORDS RefSeq. SOURCE Microcebus murinus (gray mouse lemur) ORGANISM Microcebus murinus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Strepsirrhini; Lemuriformes; Cheirogaleidae; Microcebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_033692.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Microcebus murinus Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1081 /organism="Microcebus murinus" /mol_type="mRNA" /isolate="mixed" /db_xref="taxon:30608" /chromosome="X" /sex="pooled male and female" /tissue_type="liver; kidney" /note="three separate animals were used in this assembly: #8(Reference animal), 1886F (Citronella), 7006M (Rosehip)" gene 1..1081 /gene="CLDN34" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:109730209" CDS 214..852 /gene="CLDN34" /codon_start=1 /product="claudin-34" /protein_id="XP_020140438.1" /db_xref="GeneID:109730209" /translation="
MTQVINGANHHVFGFVIATIGWILCTTSMGLVEWGVWHMDDPTFFPTGVACVGMWRVCIYHHDTNISTAKVCYRYSYSDDFLPFEVRSAQHLLLIASILGLLGRGFTMFALRNVYVRIPQKHNAYKSFLLSGMLNIMAAFCITLAVLQNYYSIKNLQGIAFPPSFHVPFKPDTQESGNAALVASIAAFLMLLSGLFYLCYKSPPESKGYPAV"
misc_feature 493..>696 /gene="CLDN34" /note="Na+/H+ antiporter subunit; Region: PhaG_MnhG_YufB; cl00583" /db_xref="CDD:444989" ORIGIN
tgggtgacgacgaaggaatgtggggacccagtgcaaggccgagggaagggcctcggtgtggctgaggtctcaggcagtctagacaggtagtggggacaaagagccaggcagggcttctgagaggagccacgtccacgagggccctgctggcccggtgacctggtgctggtcacttatacaccgtttcacagttacgttgggcacgctgccaccatgacccaggtcatcaatggcgccaatcaccacgtgtttggtttcgttattgccaccataggatggatcctctgtacaacttccatgggccttgtggagtggggagtgtggcacatggacgaccccacgttcttccccactggcgttgcctgtgtgggaatgtggagagtctgcatctaccatcatgacaccaacattagcacagccaaagtttgttatcggtactcctactctgatgactttctcccgttcgaggttcgtagtgctcaacacctcctgctgattgccagcattctagggctcctggggagaggattcaccatgtttgcacttaggaatgtatacgtgagaattcctcagaagcacaatgcctacaagtcattccttctttcagggatgctgaacataatggctgctttctgtatcacacttgccgtgctccagaattactactctatcaaaaatttacaggggattgccttcccgccatctttccatgtgcccttcaagccagatacccaggaaagcgggaatgccgctttagtggcaagtatagctgccttcctgatgctcttaagtgggttgttttatctctgctacaaatctccaccggagagcaaagggtaccctgcagtttgagaaacaggaatttcctggttgtgtgggctttgcaaatccaagattcccaagagtttatgggaagtattaccaggatgctctaccaaatatttctaaggactcaagaccatggcaaaggtagtttgagacacaaagtagccaactgtttccctctgtcacattgtgtatctaaatgtggttcattgattggttagctgaatttagaactttcaataaaaatgtatcttgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]