GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:28:50, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_019833480            3410 bp    mRNA    linear   MAM 12-DEC-2017
DEFINITION  PREDICTED: Felis catus NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X3, mRNA.
ACCESSION   XM_019833480
VERSION     XM_019833480.2
DBLINK      BioProject: PRJNA175699
KEYWORDS    RefSeq.
SOURCE      Felis catus (domestic cat)
  ORGANISM  Felis catus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Felis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_018728.3) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 12, 2017 this sequence version replaced XM_019833480.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Felis catus Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3410
                     /organism="Felis catus"
                     /mol_type="mRNA"
                     /isolate="Cinnamon"
                     /db_xref="taxon:9685"
                     /chromosome="B3"
                     /sex="female"
                     /breed="Abyssinian"
     gene            1..3410
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 24 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101094426"
     CDS             136..3300
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X3"
                     /protein_id="XP_019689039.1"
                     /db_xref="GeneID:101094426"
                     /translation="
MALFPAFAGIGETSGSGSARKELDWLSNPSFCAGAITSLSQQTEGATALVSEGSPLTRSPLKSEPSDESDTNKKPKQTSRKKKKEKKKKRKHHHKKTRRKHGRSSSSGSEPDSDSEKDKASRSIRDSKKESEKPNREGNTVADTGHRCVWLEDVQALTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGAATEKKHSHKHVERYFTKKSVGLMNIDGVAVGGKTEPPSSEPVSFIPVKGSDDVVPPVTTWLNPLGIYDQSTTQWLQGQGPSEQESKQPDSQTDREHALLKAKVEEFNRRVRENPRDIQLWMAFVAFQDEVMKSPGLYAIEEGDQEKRKRSLRLVLEKKLAILERAIESNQSSVDLKLAKLKLCSEFWEPSALAKEWQKLIFLHPNDTALWQKYLLFCQSQFSTFTVSKIHSLYGKCLSTLSAVKDGSILSHPALPGTEDAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVVISPDDDDDEPEDEDQEIREKSLPRWQIWLATERSRDERHWRPWRPDKTKKQTEEDCEDPERQVLFDDIAQSMIRLSSQDLQFQLVVAFLQFLGVPSGLSPPASCLYLAMDENSIFDDGLHDEMPLTFLNLSFSGVSCVGCSDPLGRRRWTRGHNREGEEFIRNIFHLVMPLFSGWERSQLCFSWLRYEIEKVIWCLHTKNKKRLKSQGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDAALSMAGGRDLRDRELCELGLLYAGLEAELLPDPRGAATARAVHVLTRLTEQGPCGPYSGQALAVHILKARKAYEHALQDCLGDGCVSAPAPSDSFDRLTSLVKCFMLFQYLTVGIDAAVRVYEQVLAKLKGSVPPGGSGPEDGARAQGPHGALEAVTLMHTSLLRFHTKVSLYPLAPLRQALSEALRLYPGNQVLWRAYVQIQSRSHTASETRRFFDAVTRSTKLLEPWLFAIEAEKMRKRLVESVQRW"
     misc_feature    1072..1890
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
cgggtcaagcccccgggagtgcgagtgggaaaaaccacacttcccagagtgcaccgcaaccgcgaaggcctcactaccggcgtccgctcgccggcgccatttctggagagggggacggcggtgcggcctgccgtcatggcgctgttcccggcctttgcaggcattggtgagacttccggtagcggcagcgccaggaaagaattagactggctgagcaacccaagcttttgtgctggagccataacctctctgagccaacaaactgaaggggccacagccctggtttctgaagggtcacctctgacaaggagccctctgaaatcagagccttcggatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcaccacaagaaaaccaggagaaaacatgggcggtccagcagcagtgggtctgagccagatagtgattctgagaaggataaagcttccagaagcattagagacagtaaaaaggaatccgagaaaccaaaccgagaagggaacaccgtcgctgatactgggcaccgctgcgtctggcttgaggacgttcaggctctcacaggggaaaccttcagaacagataagaaaccggatcctgcaaactgggagtataagtctctctaccgaggagatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcctgggagggggctgccacagaaaagaagcactcacacaagcatgtcgagcgctatttcacgaagaagagcgtgggactgatgaacattgacggagttgccgttggcggtaaaaccgaacctccctcatctgagccggtctcatttatcccagtgaagggctcggatgatgtggttcctcctgttacgacctggttgaaccctctggggatttacgatcagtccaccacacagtggttacaaggacagggtccttcagagcaagaatcaaagcagccagactcacagacagacagagagcatgccctgctcaaggccaaagtggaggagtttaacaggagagttcgggaaaatccccgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaagagccctggcctgtatgccatcgaggaaggagaccaggaaaagcggaagcggtctctgaggctcgtcctggagaagaagctggccatcctggagcgggccatcgaaagcaaccagagcagcgtggacctgaaactcgccaagctgaagctctgctccgagttctgggagccctccgccctggccaaagagtggcagaaactgatctttctgcatcccaacgatacagccctgtggcagaaataccttttattttgccagagccagtttagcacctttacggtgtcaaaaattcacagtctgtacggcaagtgcttgagcaccttgtctgccgtgaaggatggcagcatcttgtcgcaccccgccctgccgggcaccgaggacgccatgtttgctctctttcttcagcagtgccacttcctgcggcaggctggtcactctgagaaggcggtctctctgttccaggccatggtcgacttcaccttcttcaaacccgacagtgtgaaagacctgcccaccaaaggacaggtggaattctttgagcccttctgggacagtggggagccccgggttggcgagaagggcgcccgaggctggagagcgtggatgcaccagcaggagcggggcggctgggtggtcatcagtccagatgatgatgatgatgagccagaagatgaggaccaggaaataagagagaagagtctgcccaggtggcagatctggcttgccaccgagcggtcccgagacgagaggcactggcggccgtggcgccctgataagaccaagaagcaaaccgaggaagactgtgaggatccagagagacaggtgctgtttgatgacattgcccagtctatgatccgtctttccagccaggatcttcagtttcagctggttgtggcctttctgcagttcctgggcgtgccttctggcctcagccctccagcctcctgcctctacctggccatggatgagaacagcatcttcgatgacgggcttcatgacgaaatgccactgacttttctcaacctttccttttccggtgtcagctgtgttggctgctcagacccactgggccgccggcgctggacccggggtcacaatcgagagggcgaggagttcatccgcaacatctttcaccttgtgatgcctttgttttcaggctgggagaggtctcagctctgcttctcttggttacggtacgagatcgagaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacagggaaagaactgcaagaaactagccaaaaatctcctgaaggagccggaaaaccgcaacaatttttgcctctggaagcagtacgcacatctggagtggctgcttggcaacaccgaggacgccaggaaggtgttcgatgcggcgctcagcatggcggggggcagagacctgagggaccgtgagctgtgtgagctcggcctcctctacgccgggctggaggcagagctgttgccggacccgagaggggctgccacggcgcgagccgttcacgtactgaccaggctgacggagcaggggccctgcgggccctactccgggcaggcgctggccgttcacatcttgaaagctcggaaggcgtacgaacacgcgctgcaggactgtctgggcgacggctgtgtctccgctccggctcccagcgactccttcgaccgcctgactagcctggtgaaatgcttcatgctctttcagtacttgaccgtagggatcgatgcggccgtgcgggtgtacgagcaggtgctcgcaaaactgaagggctctgttcccccagggggctccggcccggaggacggtgcccgcgcccagggcccccacggcgcactggaggccgtgacgctgatgcacacgagcctgctcaggttccacacgaaagtcagcctttaccccctggctcctctgcgacaggctctctccgaggcgttaaggttgtacccaggcaaccaggtgctttggcgggcatacgtgcagattcagagcaggtcccacacagccagtgagaccagaagatttttcgacgcggtcaccaggtctaccaaactcttggagccttggttgtttgcgatcgaggccgagaaaatgaggaagagactggtggaaagtgttcagagatggtagagaggtgcacgccacaattcccgagaccggcttgacacatcgcatcagagccctgtttgaaaatgcgttgcggagcgacaacggcagccagtgccccttactgtggagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]