GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 19:36:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_019668891            6638 bp    mRNA    linear   MAM 20-DEC-2016
DEFINITION  PREDICTED: Hipposideros armiger ATPase copper transporting beta
            (ATP7B), transcript variant X3, mRNA.
ACCESSION   XM_019668891
VERSION     XM_019668891.1
DBLINK      BioProject: PRJNA357596
KEYWORDS    RefSeq.
SOURCE      Hipposideros armiger (great roundleaf bat)
  ORGANISM  Hipposideros armiger
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Hipposideridae; Hipposideros.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017731891.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Hipposideros armiger Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6638
                     /organism="Hipposideros armiger"
                     /mol_type="mRNA"
                     /isolate="ML-2016"
                     /db_xref="taxon:186990"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
     gene            1..6638
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 98% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:109396763"
     CDS             16..4398
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_019524436.1"
                     /db_xref="GeneID:109396763"
                     /translation="
MIPPQERPLQMRQGGYRKILSKLPLPARGREPEMKQSFAFDNAGYEGSLDGVCPPQTSTGTISILGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSVMSLPQVCCQIEDMGFEASIAEGKAGSWPSRSSPSLEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSNQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNKVAPVSLGPIDIGRLQSTNPKTPSTSINQNASNSKTVGHQGSHVVMLQLRVDGMHCTSCVRNIEENIGQLPGVQNIQVSLENRTAQVQYDPSRISPGALQRAIEALPPGNFKVSLPDGAEGSGTDNRSSTHHSPAPCQSTQVQGTCCTLVLAIAGMTCASCVQSIEGLISQREGVQQISVSLAEATGAILYDPSVINPEELRAAVEDMGFEASVVSANCSGSDSAANSTAQTAAGTPVSTQEVALHAEGPLKNHSPGHSAKSPQASATVAPQRCFLQIRGMTCASCVSNIERNLQKETGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEAAVMEDYAGSDGDIELIITGMTCASCVYNIESKLVRTNGVTHASVSLATSKAQVKFDPEIIGPRDIVKIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHGAANMDVLIVLATSIAYVYSVVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVPTELVQRGDVIKVVPGGKFPVDGKVLEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADQFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPNPSKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKINTVMFDKTGTITHGVPKVMRVLLLVDTATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTEALGYCTDFQAVPGCGIGCKVSSVEGILAHREHLSEQAAPLNGVGSVPVETDVAPQTFSVLIGNREWMRRNGLAISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAAYTLKSMGVDVVLITGDNRKTARAIAAQVGINKVFAEVLPSHKVAKVQELQKEGKKVAMVGDGINDSPALARADVGIAIGTGTDVAIEAADIVLIRNDLLDVVAGIHLSKRTVWRIRLNLVLALIYNMVGIPIAAGVFMPFGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYTAQAQGHMKPLTESQVSVHVGMDDRRWDSPRATPWDQVSYISQVSLSSLKSDKLSRHSATADDGGDKWSLLLNDRDEEQCI"
     misc_feature    196..387
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(214..222,229..231)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    451..639
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(469..477,484..486)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    793..969
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(811..819,826..828)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1099..1290
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1117..1125,1132..1134)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1477..1665
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1492..1500,1507..1509)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1702..1893
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1720..1728,1735..1737)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1957..4062
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2950..2952,2956..2958,3991..3993)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3082..3090,3292..3294,3442..3450,3538..3540,
                     3658..3666,3724..3726,3733..3735,3742..3744,3799..3801,
                     3808..3810)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
tggtttctccgggagatgatacccccacaggagaggcctctccagatgagacaaggggggtatagaaaaatcctgtctaagcttcctttgcctgctaggggccgggaaccagaaatgaagcagagttttgcctttgacaatgctggctatgaaggtagtctggatggtgtgtgccctccgcagacatccactggcaccatcagcatattgggcatgacctgccagtcatgtgtaaagtcaattgagggcaggatttccagtttgaaaggcattgtgagcattaaggtttccctggaacaaggcagtgcaactgtgaaatatgtgccgtcggtcatgagcctgccacaggtttgctgtcaaattgaggacatgggctttgaggccagcatcgcagaaggaaaggctggctcctggccttccaggtcctcgccctccctggaggccatggtcaagctgcgagtggagggcatgacttgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcaaggagtagtgagagtcagagtctcactgagcaaccaagaggcagtcatcacatatcagccttatcttattcaaccccaagacctcagggaccatgtaaacgacatggggtttgaagctgtcatcaagaacaaagtggctcccgtgagcctgggaccaattgatattgggcggttacagagcaccaacccaaagacaccttcaacttctattaaccagaatgccagtaactcaaagaccgtgggacaccaagggagccatgtggtcatgctgcaactgagagtagatggaatgcactgtacttcttgtgtccggaatattgaagaaaatattggccaactcccaggagttcaaaatattcaagtgtccttggagaacagaactgcccaagtacagtatgacccttctcgtatctccccaggggctctgcagagggccattgaggctcttccaccagggaactttaaagtttctcttcctgatggagcagaagggagtgggacagataacaggtcttccacacaccactccccagccccctgccagagtacccaggtgcaaggcacgtgctgtaccctggtgcttgccattgccggcatgacctgtgcgtcctgtgtccaatccatcgaaggcttgatctcccaaagggaaggcgtgcagcaaatatcagtctcgttggccgaagcgactggagcgattctctatgatccctctgtaattaacccagaagaactccgagctgctgtagaagacatggggtttgaggcttcggtcgtttctgcaaactgttctggaagcgacagtgcagccaattccacagcgcaaactgcagctggcacacccgtgtccacacaggaagtggctctccacgctgaggggcccctgaaaaaccatagccctggccactcggcaaagtccccgcaagcctccgcaacagtggcaccacagaggtgctttctacagatcagaggcatgacctgtgcgtcctgcgtgtctaacatagagagaaacctgcagaaagaaactggtattctctccgtgctggttgccttgatggccggaaaagcagaggttaagtataatccggaagtcatccagccacttgagatagctcagctcatccaggacttgggctttgaggcggcagtaatggaagactacgcaggctcagatggcgacattgagctgatcatcaccgggatgacctgtgcttcctgtgtgtacaacatagagtctaaacttgtaaggacgaatggcgtcacccatgcctccgtatcccttgcaaccagcaaagcccaggtgaaatttgatcctgaaattatcggtccacgagatattgtcaaaattattgaggaaatcggctttcatgcttctccagcccagagaaaccccaacgctcatcacttggaccacaaggtcgaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgttatgggtttaatgatctatatgttgataccaagcagtgaacctcacgagtctatggtcctggaccacaacatcattccgggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagttcctcggtgggtggtacttctatgttcaggcctacaaatctctgagacatggggcagccaacatggatgtgctcatcgtgctggccacgagcatcgcctacgtctactctgtcgtcattctggtggtggccattgccgagaaggctgagaggagccctgtgactttctttgacacacctcccatgctctttgtgttcattgccctgggacggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgtcgtgacccttggcgaggacaacgtaatcatcagagaagagcaagtacccacggagctggtgcagcggggtgatgtcatcaaggttgttcccgggggaaagttcccagtggacgggaaagtcctggaaggcaattccatggctgacgagtccctcatcacaggagaggccatgcctgtcaccaagaaacccggaagcacagtgattgccgggtctataaacgcacatggctctgtgctcgttaatgccacccatgtgggcaacgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccagtttagtggatattttgtcccatttatcatcatcatttcaactttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctaaccccagcaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacgtccatcacagtgctgtgcattgcctgcccctgctctctgggcctggccacacccacggcggtcatggtgggcactggcgtggctgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaatactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgcgggtcctcctgcttgtggacacagccacactgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccttaggcgtggctgtcaccaaatactgcaaagaggaacttggaacagaggccttgggatactgcacggacttccaggcggtgccaggttgtggaatcggctgtaaagtcagcagtgtggaaggcatcctggcccatcgcgagcacctgagcgaacaggccgctcccctgaacggggttggcagtgttcctgtggaaacagatgtggccccccagaccttctccgtgctgattggaaaccgagaatggatgaggcgcaacggcttagccatttccagcgacgtcagtgacgctatgacagatcacgagatgaagggccagaccgccatcttggtggctattgacggggtcctctgtgggatgatcgccattgcagatgccgtcaagcaggaggccgccctggctgcgtacacgctgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagctcgagctattgccgcccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaaggaagggaagaaagtggccatggtgggagacgggattaacgactccccggccttggcccgggctgacgtgggcatcgccatcggcacaggcacagatgtcgccatcgaggcggctgacattgttctcatcagaaacgacttgctggatgttgttgctggcattcacctctccaagaggactgtctggagaatacggctcaacctggtgctggcactgatttataacatggttgggatacccatcgcagcaggtgtcttcatgccctttgggattgtgctgcagccatggatgggctcggcggccatggcagcctcctccgtgtctgtggttctctcatctctgcagctcaagtgctataagaagccagacctggagaggtacacagcccaggcccagggccacatgaagcccctgacggagtcccaagtcagtgtgcatgtcggcatggacgaccggcgatgggactcccccagggccacgccctgggaccaggtcagctacatcagccaggtgtcgctgtcctccctgaagtccgacaagctgtctcggcacagcgccacagctgacgacggtggagacaagtggtctctgctcctgaatgacagggacgaggagcagtgcatctgaaagctccaggccgatgcagactcatgggcccatctcccagccgagcagctactcgagccccacaggggcagcgccagcagccagcagcagggtgggcgaagcctcggggacttccactccctggatattctagatcattcctccctgcagcacgtggccttggacagatatggctccccagtaggaccaccctgcctgggtcccacaggcacaggctgagacctcacccatgctgttggcgtgggcttgttggactctagaagagggaggacagccagccctccttacagacctctgcttcagtgtttgagaagactacttgtgaaatgaggaaaatttcatcaggaccaaaaacttagctgggcctttccatagagctcatgaaaaacctcggtgctgtcctctttggtacaatgaccacatgcgtcacatgtctgaaaccacaatttacctcaagtgcacctgtttgtttctgctggtaaaatctcttccttttctgtccttgacactgggggcatggcctccccatcatctgtcaggtcaggatgactgacgtcctcccggtccatgccgctgctctcaggtgcttctctaagcgcaggcacgtgtgtgcacttctacctgaatcttctcactcacacgcttggcccaagagcttgtcaggcttcccttcaggttgaggggagttctttcatgcttacgagactctcttcacagagtcatggcttctcactccacactcttgctgcccagctggagtaagggtctcagagcctgagacttgagaaatccagcttcctgtggggttcaggtgcctgggacccggagaggcctgtggtgcttaaagcaggtgtcctgtggggaaggctcatgcataggaacctcctttgtggcttcaggagcttcgattatattgttcacctccaaggaaaacagtgatacccaaattagaggaaatcacagttcttttcatgagcttctacttctgcatgttgagttggtgccttaggaaaggggtgattgcaatttcccaaagggaagtctgtctctaactttcagtggctctttgtgattgcatgacgttggaggggcaggattgtagctagttttagactctgaatttggtgttgattgacagaccacatgagaatagacgagtagaatcagaatcttagaataagtagagcaaagcctattctaaattctaaatgtgctgcctgtctaaatcctaaggtgaatcccttgtcatacacaaaaaataattttatttatcgaatgtgttattttccaaggcaatgtaaacactttttataagttacctctaatgctcccaacaaaccaacaaagtagatattattgtccacctttcacaagtgggaaaataggctcagagaggctaagtatcctccccaggatcacacagccagtatatatgccagaacaggggtctgaatccatgtctgttggctctgaagtcttttctttatctcggctccactttgaatattttgcttgataagaatacacaagaaaaagccccttgctcctggaagaacaaatctgtcaggtgatgtattgatgtggactgaactttgatcatgaggtcatctcacttgatgacctcatggtcaagttcatttcccttggatggtttgttttcacttttgcatataattctgtttttgctgggtcttatcctctaaaatccacgtgcagggttctgtttctattgttatcaatctcccttttcctccccagcaccttcctgccatgtgtccccgctggtgtcatctttattctttgctgtgcttggggaatgtttctcgttttctaactaggctaatcatcatctaaagaatctcattgtattgatttttcaaaaaacttttaggaccgtaaatattgtgtttatacagacataaaaatatttgtataattgtacagaaaaatcaacttttagatgttcgaagtgtaggaatttttttttggttagataagaacaatttctacttcaaaaactttccgtgctatattagaataaagtttctttttcatcagaagatgtgcttttggctggccgtgtctgagtgaggagtgtggtgaagggtgggcagtgctgtcttcagggagaactgcaagggactggctttgcgctcggtgccttttcgggggagagagggatggtttctttctttcttttaagatttttattaaaaatatagttcgcgtacaatattcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]