2024-03-29 09:07:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_019668890 6588 bp mRNA linear MAM 20-DEC-2016 DEFINITION PREDICTED: Hipposideros armiger ATPase copper transporting beta (ATP7B), transcript variant X2, mRNA. ACCESSION XM_019668890 VERSION XM_019668890.1 DBLINK BioProject: PRJNA357596 KEYWORDS RefSeq. SOURCE Hipposideros armiger (great roundleaf bat) ORGANISM Hipposideros armiger Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Hipposideridae; Hipposideros. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017731891.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Hipposideros armiger Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6588 /organism="Hipposideros armiger" /mol_type="mRNA" /isolate="ML-2016" /db_xref="taxon:186990" /chromosome="Unknown" /sex="female" /tissue_type="muscle" gene 1..6588 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:109396763" CDS 65..4348 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X2" /protein_id="XP_019524435.1" /db_xref="GeneID:109396763" /translation="
MKQSFAFDNAGYEGSLDGVCPPQTSTGTISILGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSVMSLPQVCCQIEDMGFEASIAEGKAGSWPSRSSPSLEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSNQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNKVAPVSLGPIDIGRLQSTNPKTPSTSINQNASNSKTVGHQGSHVVMLQLRVDGMHCTSCVRNIEENIGQLPGVQNIQVSLENRTAQVQYDPSRISPGALQRAIEALPPGNFKVSLPDGAEGSGTDNRSSTHHSPAPCQSTQVQGTCCTLVLAIAGMTCASCVQSIEGLISQREGVQQISVSLAEATGAILYDPSVINPEELRAAVEDMGFEASVVSANCSGSDSAANSTAQTAAGTPVSTQEVALHAEGPLKNHSPGHSAKSPQASATVAPQRCFLQIRGMTCASCVSNIERNLQKETGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEAAVMEDYAGSDGDIELIITGMTCASCVYNIESKLVRTNGVTHASVSLATSKAQVKFDPEIIGPRDIVKIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHGAANMDVLIVLATSIAYVYSVVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVPTELVQRGDVIKVVPGGKFPVDGKVLEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADQFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPNPSKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKINTVMFDKTGTITHGVPKVMRVLLLVDTATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTEALGYCTDFQAVPGCGIGCKVSSVEGILAHREHLSEQAAPLNGVGSVPVETDVAPQTFSVLIGNREWMRRNGLAISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAAYTLKSMGVDVVLITGDNRKTARAIAAQVGINKVFAEVLPSHKVAKVQELQKEGKKVAMVGDGINDSPALARADVGIAIGTGTDVAIEAADIVLIRNDLLDVVAGIHLSKRTVWRIRLNLVLALIYNMVGIPIAAGVFMPFGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYTAQAQGHMKPLTESQVSVHVGMDDRRWDSPRATPWDQVSYISQVSLSSLKSDKLSRHSATADDGGDKWSLLLNDRDEEQCI"
misc_feature 146..337 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(164..172,179..181) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 401..589 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(419..427,434..436) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 743..919 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(761..769,776..778) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1049..1240 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1067..1075,1082..1084) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1427..1615 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1442..1450,1457..1459) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1652..1843 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1670..1678,1685..1687) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1907..4012 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2900..2902,2906..2908,3941..3943) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3032..3040,3242..3244,3392..3400,3488..3490, 3608..3616,3674..3676,3683..3685,3692..3694,3749..3751, 3758..3760) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
cttaggagcacactgtgaaatcctgtctaagcttcctttgcctgctaggggccgggaaccagaaatgaagcagagttttgcctttgacaatgctggctatgaaggtagtctggatggtgtgtgccctccgcagacatccactggcaccatcagcatattgggcatgacctgccagtcatgtgtaaagtcaattgagggcaggatttccagtttgaaaggcattgtgagcattaaggtttccctggaacaaggcagtgcaactgtgaaatatgtgccgtcggtcatgagcctgccacaggtttgctgtcaaattgaggacatgggctttgaggccagcatcgcagaaggaaaggctggctcctggccttccaggtcctcgccctccctggaggccatggtcaagctgcgagtggagggcatgacttgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcaaggagtagtgagagtcagagtctcactgagcaaccaagaggcagtcatcacatatcagccttatcttattcaaccccaagacctcagggaccatgtaaacgacatggggtttgaagctgtcatcaagaacaaagtggctcccgtgagcctgggaccaattgatattgggcggttacagagcaccaacccaaagacaccttcaacttctattaaccagaatgccagtaactcaaagaccgtgggacaccaagggagccatgtggtcatgctgcaactgagagtagatggaatgcactgtacttcttgtgtccggaatattgaagaaaatattggccaactcccaggagttcaaaatattcaagtgtccttggagaacagaactgcccaagtacagtatgacccttctcgtatctccccaggggctctgcagagggccattgaggctcttccaccagggaactttaaagtttctcttcctgatggagcagaagggagtgggacagataacaggtcttccacacaccactccccagccccctgccagagtacccaggtgcaaggcacgtgctgtaccctggtgcttgccattgccggcatgacctgtgcgtcctgtgtccaatccatcgaaggcttgatctcccaaagggaaggcgtgcagcaaatatcagtctcgttggccgaagcgactggagcgattctctatgatccctctgtaattaacccagaagaactccgagctgctgtagaagacatggggtttgaggcttcggtcgtttctgcaaactgttctggaagcgacagtgcagccaattccacagcgcaaactgcagctggcacacccgtgtccacacaggaagtggctctccacgctgaggggcccctgaaaaaccatagccctggccactcggcaaagtccccgcaagcctccgcaacagtggcaccacagaggtgctttctacagatcagaggcatgacctgtgcgtcctgcgtgtctaacatagagagaaacctgcagaaagaaactggtattctctccgtgctggttgccttgatggccggaaaagcagaggttaagtataatccggaagtcatccagccacttgagatagctcagctcatccaggacttgggctttgaggcggcagtaatggaagactacgcaggctcagatggcgacattgagctgatcatcaccgggatgacctgtgcttcctgtgtgtacaacatagagtctaaacttgtaaggacgaatggcgtcacccatgcctccgtatcccttgcaaccagcaaagcccaggtgaaatttgatcctgaaattatcggtccacgagatattgtcaaaattattgaggaaatcggctttcatgcttctccagcccagagaaaccccaacgctcatcacttggaccacaaggtcgaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgttatgggtttaatgatctatatgttgataccaagcagtgaacctcacgagtctatggtcctggaccacaacatcattccgggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagttcctcggtgggtggtacttctatgttcaggcctacaaatctctgagacatggggcagccaacatggatgtgctcatcgtgctggccacgagcatcgcctacgtctactctgtcgtcattctggtggtggccattgccgagaaggctgagaggagccctgtgactttctttgacacacctcccatgctctttgtgttcattgccctgggacggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgtcgtgacccttggcgaggacaacgtaatcatcagagaagagcaagtacccacggagctggtgcagcggggtgatgtcatcaaggttgttcccgggggaaagttcccagtggacgggaaagtcctggaaggcaattccatggctgacgagtccctcatcacaggagaggccatgcctgtcaccaagaaacccggaagcacagtgattgccgggtctataaacgcacatggctctgtgctcgttaatgccacccatgtgggcaacgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccagtttagtggatattttgtcccatttatcatcatcatttcaactttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctaaccccagcaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacgtccatcacagtgctgtgcattgcctgcccctgctctctgggcctggccacacccacggcggtcatggtgggcactggcgtggctgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaatactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgcgggtcctcctgcttgtggacacagccacactgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccttaggcgtggctgtcaccaaatactgcaaagaggaacttggaacagaggccttgggatactgcacggacttccaggcggtgccaggttgtggaatcggctgtaaagtcagcagtgtggaaggcatcctggcccatcgcgagcacctgagcgaacaggccgctcccctgaacggggttggcagtgttcctgtggaaacagatgtggccccccagaccttctccgtgctgattggaaaccgagaatggatgaggcgcaacggcttagccatttccagcgacgtcagtgacgctatgacagatcacgagatgaagggccagaccgccatcttggtggctattgacggggtcctctgtgggatgatcgccattgcagatgccgtcaagcaggaggccgccctggctgcgtacacgctgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagctcgagctattgccgcccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaaggaagggaagaaagtggccatggtgggagacgggattaacgactccccggccttggcccgggctgacgtgggcatcgccatcggcacaggcacagatgtcgccatcgaggcggctgacattgttctcatcagaaacgacttgctggatgttgttgctggcattcacctctccaagaggactgtctggagaatacggctcaacctggtgctggcactgatttataacatggttgggatacccatcgcagcaggtgtcttcatgccctttgggattgtgctgcagccatggatgggctcggcggccatggcagcctcctccgtgtctgtggttctctcatctctgcagctcaagtgctataagaagccagacctggagaggtacacagcccaggcccagggccacatgaagcccctgacggagtcccaagtcagtgtgcatgtcggcatggacgaccggcgatgggactcccccagggccacgccctgggaccaggtcagctacatcagccaggtgtcgctgtcctccctgaagtccgacaagctgtctcggcacagcgccacagctgacgacggtggagacaagtggtctctgctcctgaatgacagggacgaggagcagtgcatctgaaagctccaggccgatgcagactcatgggcccatctcccagccgagcagctactcgagccccacaggggcagcgccagcagccagcagcagggtgggcgaagcctcggggacttccactccctggatattctagatcattcctccctgcagcacgtggccttggacagatatggctccccagtaggaccaccctgcctgggtcccacaggcacaggctgagacctcacccatgctgttggcgtgggcttgttggactctagaagagggaggacagccagccctccttacagacctctgcttcagtgtttgagaagactacttgtgaaatgaggaaaatttcatcaggaccaaaaacttagctgggcctttccatagagctcatgaaaaacctcggtgctgtcctctttggtacaatgaccacatgcgtcacatgtctgaaaccacaatttacctcaagtgcacctgtttgtttctgctggtaaaatctcttccttttctgtccttgacactgggggcatggcctccccatcatctgtcaggtcaggatgactgacgtcctcccggtccatgccgctgctctcaggtgcttctctaagcgcaggcacgtgtgtgcacttctacctgaatcttctcactcacacgcttggcccaagagcttgtcaggcttcccttcaggttgaggggagttctttcatgcttacgagactctcttcacagagtcatggcttctcactccacactcttgctgcccagctggagtaagggtctcagagcctgagacttgagaaatccagcttcctgtggggttcaggtgcctgggacccggagaggcctgtggtgcttaaagcaggtgtcctgtggggaaggctcatgcataggaacctcctttgtggcttcaggagcttcgattatattgttcacctccaaggaaaacagtgatacccaaattagaggaaatcacagttcttttcatgagcttctacttctgcatgttgagttggtgccttaggaaaggggtgattgcaatttcccaaagggaagtctgtctctaactttcagtggctctttgtgattgcatgacgttggaggggcaggattgtagctagttttagactctgaatttggtgttgattgacagaccacatgagaatagacgagtagaatcagaatcttagaataagtagagcaaagcctattctaaattctaaatgtgctgcctgtctaaatcctaaggtgaatcccttgtcatacacaaaaaataattttatttatcgaatgtgttattttccaaggcaatgtaaacactttttataagttacctctaatgctcccaacaaaccaacaaagtagatattattgtccacctttcacaagtgggaaaataggctcagagaggctaagtatcctccccaggatcacacagccagtatatatgccagaacaggggtctgaatccatgtctgttggctctgaagtcttttctttatctcggctccactttgaatattttgcttgataagaatacacaagaaaaagccccttgctcctggaagaacaaatctgtcaggtgatgtattgatgtggactgaactttgatcatgaggtcatctcacttgatgacctcatggtcaagttcatttcccttggatggtttgttttcacttttgcatataattctgtttttgctgggtcttatcctctaaaatccacgtgcagggttctgtttctattgttatcaatctcccttttcctccccagcaccttcctgccatgtgtccccgctggtgtcatctttattctttgctgtgcttggggaatgtttctcgttttctaactaggctaatcatcatctaaagaatctcattgtattgatttttcaaaaaacttttaggaccgtaaatattgtgtttatacagacataaaaatatttgtataattgtacagaaaaatcaacttttagatgttcgaagtgtaggaatttttttttggttagataagaacaatttctacttcaaaaactttccgtgctatattagaataaagtttctttttcatcagaagatgtgcttttggctggccgtgtctgagtgaggagtgtggtgaagggtgggcagtgctgtcttcagggagaactgcaagggactggctttgcgctcggtgccttttcgggggagagagggatggtttctttctttcttttaagatttttattaaaaatatagttcgcgtacaatattcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]