LOCUS       XM_019668889            7000 bp    mRNA    linear   MAM 20-DEC-2016
DEFINITION  PREDICTED: Hipposideros armiger ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_019668889
VERSION     XM_019668889.1
DBLINK      BioProject: PRJNA357596
KEYWORDS    RefSeq.
SOURCE      Hipposideros armiger (great roundleaf bat)
  ORGANISM  Hipposideros armiger
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Hipposideridae; Hipposideros.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017731891.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Hipposideros armiger Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7000
                     /organism="Hipposideros armiger"
                     /mol_type="mRNA"
                     /isolate="ML-2016"
                     /db_xref="taxon:186990"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
     gene            1..7000
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109396763"
     CDS             195..4760
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_019524434.1"
                     /db_xref="GeneID:109396763"
                     /translation="

MEKAGSETPGNPEQSYLATLCDSQVTLLSVHKQWSFRRSPGVRGPSRPAPSEEEGSPPSLEGECSQKVLNGTREISSSQILSKLPLPARGREPEMKQSFAFDNAGYEGSLDGVCPPQTSTGTISILGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSVMSLPQVCCQIEDMGFEASIAEGKAGSWPSRSSPSLEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSNQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNKVAPVSLGPIDIGRLQSTNPKTPSTSINQNASNSKTVGHQGSHVVMLQLRVDGMHCTSCVRNIEENIGQLPGVQNIQVSLENRTAQVQYDPSRISPGALQRAIEALPPGNFKVSLPDGAEGSGTDNRSSTHHSPAPCQSTQVQGTCCTLVLAIAGMTCASCVQSIEGLISQREGVQQISVSLAEATGAILYDPSVINPEELRAAVEDMGFEASVVSANCSGSDSAANSTAQTAAGTPVSTQEVALHAEGPLKNHSPGHSAKSPQASATVAPQRCFLQIRGMTCASCVSNIERNLQKETGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEAAVMEDYAGSDGDIELIITGMTCASCVYNIESKLVRTNGVTHASVSLATSKAQVKFDPEIIGPRDIVKIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHGAANMDVLIVLATSIAYVYSVVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVPTELVQRGDVIKVVPGGKFPVDGKVLEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADQFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPNPSKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKINTVMFDKTGTITHGVPKVMRVLLLVDTATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTEALGYCTDFQAVPGCGIGCKVSSVEGILAHREHLSEQAAPLNGVGSVPVETDVAPQTFSVLIGNREWMRRNGLAISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAAYTLKSMGVDVVLITGDNRKTARAIAAQVGINKVFAEVLPSHKVAKVQELQKEGKKVAMVGDGINDSPALARADVGIAIGTGTDVAIEAADIVLIRNDLLDVVAGIHLSKRTVWRIRLNLVLALIYNMVGIPIAAGVFMPFGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYTAQAQGHMKPLTESQVSVHVGMDDRRWDSPRATPWDQVSYISQVSLSSLKSDKLSRHSATADDGGDKWSLLLNDRDEEQCI"

     misc_feature    558..749
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(576..584,591..593)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    813..1001
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(831..839,846..848)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1155..1331
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1173..1181,1188..1190)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1461..1652
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1479..1487,1494..1496)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1839..2027
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1854..1862,1869..1871)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2064..2255
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2082..2090,2097..2099)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2319..4424
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3312..3314,3318..3320,4353..4355)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3444..3452,3654..3656,3804..3812,3900..3902,
                     4020..4028,4086..4088,4095..4097,4104..4106,4161..4163,
                     4170..4172)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

cttgctgcctgacagactcggcagcagcctctccccggctggctcaggagcagagggggaacctgcaagactgaacacagaggatgccttcccctttctagttaggagacactttaagcatttccttctttgttgaccacgtagactggtgaaggtgaattgctttaggggtgaaggtgagactggacgcagccatggagaaagccgggagtgagacgcccgggaaccctgagcagtcctacctggcgactctgtgtgactcccaggtgaccctgctgtctgtccacaagcagtggtccttcaggaggagccctggggtcaggggcccctccaggccggcgccttcggaggaggaaggctctcccccatcactggagggagaatgttcccagaaggttttgaatggaacacgggaaatcagttccagtcagatcctgtctaagcttcctttgcctgctaggggccgggaaccagaaatgaagcagagttttgcctttgacaatgctggctatgaaggtagtctggatggtgtgtgccctccgcagacatccactggcaccatcagcatattgggcatgacctgccagtcatgtgtaaagtcaattgagggcaggatttccagtttgaaaggcattgtgagcattaaggtttccctggaacaaggcagtgcaactgtgaaatatgtgccgtcggtcatgagcctgccacaggtttgctgtcaaattgaggacatgggctttgaggccagcatcgcagaaggaaaggctggctcctggccttccaggtcctcgccctccctggaggccatggtcaagctgcgagtggagggcatgacttgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcaaggagtagtgagagtcagagtctcactgagcaaccaagaggcagtcatcacatatcagccttatcttattcaaccccaagacctcagggaccatgtaaacgacatggggtttgaagctgtcatcaagaacaaagtggctcccgtgagcctgggaccaattgatattgggcggttacagagcaccaacccaaagacaccttcaacttctattaaccagaatgccagtaactcaaagaccgtgggacaccaagggagccatgtggtcatgctgcaactgagagtagatggaatgcactgtacttcttgtgtccggaatattgaagaaaatattggccaactcccaggagttcaaaatattcaagtgtccttggagaacagaactgcccaagtacagtatgacccttctcgtatctccccaggggctctgcagagggccattgaggctcttccaccagggaactttaaagtttctcttcctgatggagcagaagggagtgggacagataacaggtcttccacacaccactccccagccccctgccagagtacccaggtgcaaggcacgtgctgtaccctggtgcttgccattgccggcatgacctgtgcgtcctgtgtccaatccatcgaaggcttgatctcccaaagggaaggcgtgcagcaaatatcagtctcgttggccgaagcgactggagcgattctctatgatccctctgtaattaacccagaagaactccgagctgctgtagaagacatggggtttgaggcttcggtcgtttctgcaaactgttctggaagcgacagtgcagccaattccacagcgcaaactgcagctggcacacccgtgtccacacaggaagtggctctccacgctgaggggcccctgaaaaaccatagccctggccactcggcaaagtccccgcaagcctccgcaacagtggcaccacagaggtgctttctacagatcagaggcatgacctgtgcgtcctgcgtgtctaacatagagagaaacctgcagaaagaaactggtattctctccgtgctggttgccttgatggccggaaaagcagaggttaagtataatccggaagtcatccagccacttgagatagctcagctcatccaggacttgggctttgaggcggcagtaatggaagactacgcaggctcagatggcgacattgagctgatcatcaccgggatgacctgtgcttcctgtgtgtacaacatagagtctaaacttgtaaggacgaatggcgtcacccatgcctccgtatcccttgcaaccagcaaagcccaggtgaaatttgatcctgaaattatcggtccacgagatattgtcaaaattattgaggaaatcggctttcatgcttctccagcccagagaaaccccaacgctcatcacttggaccacaaggtcgaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgttatgggtttaatgatctatatgttgataccaagcagtgaacctcacgagtctatggtcctggaccacaacatcattccgggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagttcctcggtgggtggtacttctatgttcaggcctacaaatctctgagacatggggcagccaacatggatgtgctcatcgtgctggccacgagcatcgcctacgtctactctgtcgtcattctggtggtggccattgccgagaaggctgagaggagccctgtgactttctttgacacacctcccatgctctttgtgttcattgccctgggacggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgtcgtgacccttggcgaggacaacgtaatcatcagagaagagcaagtacccacggagctggtgcagcggggtgatgtcatcaaggttgttcccgggggaaagttcccagtggacgggaaagtcctggaaggcaattccatggctgacgagtccctcatcacaggagaggccatgcctgtcaccaagaaacccggaagcacagtgattgccgggtctataaacgcacatggctctgtgctcgttaatgccacccatgtgggcaacgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccagtttagtggatattttgtcccatttatcatcatcatttcaactttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctaaccccagcaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacgtccatcacagtgctgtgcattgcctgcccctgctctctgggcctggccacacccacggcggtcatggtgggcactggcgtggctgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaatactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgcgggtcctcctgcttgtggacacagccacactgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccttaggcgtggctgtcaccaaatactgcaaagaggaacttggaacagaggccttgggatactgcacggacttccaggcggtgccaggttgtggaatcggctgtaaagtcagcagtgtggaaggcatcctggcccatcgcgagcacctgagcgaacaggccgctcccctgaacggggttggcagtgttcctgtggaaacagatgtggccccccagaccttctccgtgctgattggaaaccgagaatggatgaggcgcaacggcttagccatttccagcgacgtcagtgacgctatgacagatcacgagatgaagggccagaccgccatcttggtggctattgacggggtcctctgtgggatgatcgccattgcagatgccgtcaagcaggaggccgccctggctgcgtacacgctgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagctcgagctattgccgcccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaaggaagggaagaaagtggccatggtgggagacgggattaacgactccccggccttggcccgggctgacgtgggcatcgccatcggcacaggcacagatgtcgccatcgaggcggctgacattgttctcatcagaaacgacttgctggatgttgttgctggcattcacctctccaagaggactgtctggagaatacggctcaacctggtgctggcactgatttataacatggttgggatacccatcgcagcaggtgtcttcatgccctttgggattgtgctgcagccatggatgggctcggcggccatggcagcctcctccgtgtctgtggttctctcatctctgcagctcaagtgctataagaagccagacctggagaggtacacagcccaggcccagggccacatgaagcccctgacggagtcccaagtcagtgtgcatgtcggcatggacgaccggcgatgggactcccccagggccacgccctgggaccaggtcagctacatcagccaggtgtcgctgtcctccctgaagtccgacaagctgtctcggcacagcgccacagctgacgacggtggagacaagtggtctctgctcctgaatgacagggacgaggagcagtgcatctgaaagctccaggccgatgcagactcatgggcccatctcccagccgagcagctactcgagccccacaggggcagcgccagcagccagcagcagggtgggcgaagcctcggggacttccactccctggatattctagatcattcctccctgcagcacgtggccttggacagatatggctccccagtaggaccaccctgcctgggtcccacaggcacaggctgagacctcacccatgctgttggcgtgggcttgttggactctagaagagggaggacagccagccctccttacagacctctgcttcagtgtttgagaagactacttgtgaaatgaggaaaatttcatcaggaccaaaaacttagctgggcctttccatagagctcatgaaaaacctcggtgctgtcctctttggtacaatgaccacatgcgtcacatgtctgaaaccacaatttacctcaagtgcacctgtttgtttctgctggtaaaatctcttccttttctgtccttgacactgggggcatggcctccccatcatctgtcaggtcaggatgactgacgtcctcccggtccatgccgctgctctcaggtgcttctctaagcgcaggcacgtgtgtgcacttctacctgaatcttctcactcacacgcttggcccaagagcttgtcaggcttcccttcaggttgaggggagttctttcatgcttacgagactctcttcacagagtcatggcttctcactccacactcttgctgcccagctggagtaagggtctcagagcctgagacttgagaaatccagcttcctgtggggttcaggtgcctgggacccggagaggcctgtggtgcttaaagcaggtgtcctgtggggaaggctcatgcataggaacctcctttgtggcttcaggagcttcgattatattgttcacctccaaggaaaacagtgatacccaaattagaggaaatcacagttcttttcatgagcttctacttctgcatgttgagttggtgccttaggaaaggggtgattgcaatttcccaaagggaagtctgtctctaactttcagtggctctttgtgattgcatgacgttggaggggcaggattgtagctagttttagactctgaatttggtgttgattgacagaccacatgagaatagacgagtagaatcagaatcttagaataagtagagcaaagcctattctaaattctaaatgtgctgcctgtctaaatcctaaggtgaatcccttgtcatacacaaaaaataattttatttatcgaatgtgttattttccaaggcaatgtaaacactttttataagttacctctaatgctcccaacaaaccaacaaagtagatattattgtccacctttcacaagtgggaaaataggctcagagaggctaagtatcctccccaggatcacacagccagtatatatgccagaacaggggtctgaatccatgtctgttggctctgaagtcttttctttatctcggctccactttgaatattttgcttgataagaatacacaagaaaaagccccttgctcctggaagaacaaatctgtcaggtgatgtattgatgtggactgaactttgatcatgaggtcatctcacttgatgacctcatggtcaagttcatttcccttggatggtttgttttcacttttgcatataattctgtttttgctgggtcttatcctctaaaatccacgtgcagggttctgtttctattgttatcaatctcccttttcctccccagcaccttcctgccatgtgtccccgctggtgtcatctttattctttgctgtgcttggggaatgtttctcgttttctaactaggctaatcatcatctaaagaatctcattgtattgatttttcaaaaaacttttaggaccgtaaatattgtgtttatacagacataaaaatatttgtataattgtacagaaaaatcaacttttagatgttcgaagtgtaggaatttttttttggttagataagaacaatttctacttcaaaaactttccgtgctatattagaataaagtttctttttcatcagaagatgtgcttttggctggccgtgtctgagtgaggagtgtggtgaagggtgggcagtgctgtcttcagggagaactgcaagggactggctttgcgctcggtgccttttcgggggagagagggatggtttctttctttcttttaagatttttattaaaaatatagttcgcgtacaatattcta

//