2024-04-26 00:29:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_019612126 5953 bp mRNA linear VRT 18-NOV-2019 DEFINITION PREDICTED: Meleagris gallopavo ATPase copper transporting beta (ATP7B), transcript variant X7, mRNA. ACCESSION XM_019612126 VERSION XM_019612126.2 DBLINK BioProject: PRJNA62397 KEYWORDS RefSeq. SOURCE Meleagris gallopavo (turkey) ORGANISM Meleagris gallopavo Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Meleagridinae; Meleagris. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_015011.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Nov 18, 2019 this sequence version replaced XM_019612126.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Meleagris gallopavo Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..5953 /organism="Meleagris gallopavo" /mol_type="mRNA" /isolate="NT-WF06-2002-E0010" /db_xref="taxon:9103" /chromosome="1" /sex="female" /tissue_type="blood" /breed="Aviagen turkey brand Nicholas breeding stock" /note="donated by Nicholas Turkey Breeding Farms" gene 1..5953 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 23 samples with support for all annotated introns" /db_xref="GeneID:100541545" CDS 73..4476 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X7" /protein_id="XP_019467671.1" /db_xref="GeneID:100541545" /translation="
MKQNFAFDNMGYEETFEAMPSSSSQERTVAVNVVGMTCQSCVQSIEGRISKVKGVVSIKVSLELNNALVKYLQSEISPEQICQEIEDMGFDANVAEERLTPVSVNLPCSREAVMKLRIEGMTCQSCVTSIEGKIKKLHGVAKIKVSLSNQEAVIAYHPYIIQPEELRSHISNLGYDCTIKSKSAPLKLGVLDVRNLQSADPKKTPASLESEGLHPLIANNSSTATVTVHIEGMHCKSCVRNIEGNISSLPGIQSIEVSLEHKCAVVQYSPNLITLPALQQAIESLPPGNFKVCLPNTSEANNQASPSPALVCDLFREPLKDTMCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLADKTGTIHYDPANTNGEELRAAIEEMGFDASLLTDIGAGEYKHCPDASSTAAQPRVPEPPHQGCVSDALPDSPHPDEPNQPSGATAKKCFLQVTGMTCASCVSTIERNLQKEEGIVSVLVALMAGKAEIKYKPDLIQPLEIAQLIQNLGFEATVIEDHSEIEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEGIGFHASVSRRVPNTHNLDHRKEIQQWRKSFLCSLVFGIPVLILMIYMLIPGGEHHGAMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYIQAYKSLKHKAANMDVLIVLATTIAYVYSCVILLVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHTIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDIIQKYFPNQNKHLSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVVGMAEEGVDKLDANKSGDSSAPVGDDTLITLSESNGSSSSHTYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNERRRVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRVSTAVLTCLLSLFVALFSSVFKRLHVEYFQCASVLQNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRSAPWDQISQVSLSSLTSDKLPRQNGFFEEEGDKWSLLMNGGDEEQYI"
misc_feature 163..348 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(178..186,193..195) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 415..606 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(433..441,448..450) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 760..927 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(769..777,784..786) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1051..1242 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1069..1077,1084..1086) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1420..1608 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1435..1443,1450..1452) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1645..1836 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1663..1671,1678..1680) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1900..4149 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2893..2895,2899..2901,4078..4080) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3025..3033,3235..3237,3421..3429,3517..3519, 3637..3645,3703..3705,3712..3714,3721..3723,3778..3780, 3787..3789) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
ggatcaagcaggacctccattaaggttttgtccaatgctgactctcctcctagctgtgcgctggaacctgaaatgaaacagaattttgcttttgacaacatgggctacgaggagacctttgaagccatgccctcatcatcttcccaggaacgcactgttgcagtcaatgttgtgggaatgacttgtcaatcttgtgtgcagtcgatagaaggacgaatttccaaagttaagggtgttgtgagtattaaagtctcccttgaactgaataatgctttagtaaaatatctacagtcagaaataagccctgaacagatttgccaagaaatagaggatatgggctttgacgccaatgtagcagaagaaaggttgacaccagtatctgtaaatttgccatgctcgagagaagcagtaatgaagcttcggatagaaggcatgacgtgccagtcctgcgtcaccagcattgaaggaaagattaagaagcttcacggtgtggcaaaaatcaaggtgtcactcagtaaccaggaagcagttattgcttaccatccttacatcattcagcctgaggaacttaggagccacatcagtaacctggggtacgactgcaccattaagagtaaatcagcacctttgaagcttggtgtgcttgatgtcaggaacctgcagagtgcagaccccaagaagacaccagcatctctcgagagtgagggtttgcatccgctgattgccaacaacagcagcacagctacagtgactgtacatatagaaggcatgcactgcaaatcttgtgtcagaaacattgaaggaaatatatcctctcttccaggcatacaaagtattgaagtctccttggagcataaatgtgctgttgtacagtatagccccaatttaattaccttgcctgctttgcagcaagctattgaatcccttccacctggaaactttaaagtttgcctccctaatacttcagaagcaaataaccaggcatctccatctcctgctttggtatgtgatctcttcagagagccactgaaagacacaatgtgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaaggaacaatatctcagagacaaggtgtgcagcatgtagcagtttctttagctgacaagactgggaccatacattatgatccagcaaacacgaatggtgaggagttgagagctgccatagaagaaatggggtttgatgcatctttgctgacagatattggtgcaggagaatacaagcattgccctgatgccagtagcaccgcagcgcagcctcgagtcccagagcctcctcaccagggttgtgtctccgatgcacttccagacagccctcaccctgatgagccaaaccaacccagcggagcaacagccaagaagtgttttttacaagtcactggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagaaggtattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagcctgacttgatacagcctcttgaaatagcacagttgatccagaatttgggttttgaagccactgtcatagaagatcattcagaaatagaaggaaatgtggagctgcttattacggggatgacttgtgcctcctgtgttcacaatattgaatccaaacttatgagaacaaacggcatattctacgcctcagttgctcttgctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagatattataaaaataattgagggaattggctttcatgcttctgtgtctagaagagttccaaatacacataacttggatcacagaaaggaaatacagcagtggaggaagtcttttttgtgcagccttgtgtttggtattcctgtcttaatcctaatgatttatatgctaatacctggcggcgaacaccacggggctatggtgctggagcagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacatacaagcttacaagtcactgaagcacaaggcagccaatatggatgtgcttatcgtactggccacaacaattgcttacgtgtattcatgtgtgatcctgttggtggcaataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccaatgctgtttgtattcattgcccttgggagatggcttgaacatatagcaaagagtaagacctcagaagctcttgctaaacttatatctctccaagccacggaagccactgtggtgactcttggacctgaccacactatcatcagagaggagcaggtacctgttgaactggttcaaaggggtgatattgtaaaggttgttccaggtggaaagttcccagtggatgggaaggtcattgaaggcaattctatggcagacgagtctctcattactggggaagctatgcctgtcactaaaaagcctgggagcacagtgattgctggctctataaatgcacatggctcagttcttgttaacgcaactcatgttggtaatgataccaccctggcacagatagtgaaattggtggaagaagctcaaatgtcaaaggcaccaatccagcaactggcagataagtttagtggatattttgttccatttatcatcataatttctacagtgactttgatagtatggatcacaattggttttataaattttgatattattcagaaatattttcctaatcagaacaagcacctttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctaccccaacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggcggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaacggggaccattacttgtggagtccctaaagtcatgagggttcttctgctgggagacacagccgtgctctctctgaagaaggtactggcagtggtcggcactgcagaagccagcagtgagcatcctttaggagtggcggtcactaaatactgcaaagaggagcttggaactcagagcctgggatactgcaccaacttccaggcagtcccaggttgtggcatcagctgcaaagtaggtggtgttgaggctgtcgtgggcatggctgaggagggtgttgataagttggacgctaacaagagtggggacagcagtgctcctgtgggagatgacacactgatcacactttctgaatcgaatggttcatcatcttcccacacatactcagtattgattggaaatcgtgagtggatgcgacggaatggcttgcacattgcaaatgatgtcaatgatgccatgacagaccatgaaactaaaggacagacagccatattagtggctatagatggtgccttatgtggaatgattgcaatcgcagacactgtcaagcaggaggcagccctggctgtgcacacactgaaaaacatgggaatagatgtagtgctgataacgggcgacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaagaactccaaaatgagaggagaagggttgcgatggttggtgacggagtcaatgattcccctgcgctagccagggccgacattggaattgcaattggaacgggtaccgatgttgccattgaagcagcagatgttgttcttatccgagtgagcactgcagttttgacctgccttctgtcactttttgtagctcttttcagttcagtattcaaaagactgcatgtggaatactttcagtgcgcttctgtcttacagaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagtgaggagaatacgaataaatctgattcttgccttaatttataatctgcttggaataccaatagcagcaggtgtgttcatgcctgctggtcttgtgcttcagccttggatgggatcagctgccatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagctcaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagatcggctccttgggatcaaattagtcaagtttctctctcttccttgacttcagacaagctcccgagacaaaatgggttttttgaggaggaaggggacaagtggtcactgctgatgaatggaggagatgaagaacagtacatctgaagtgttgtgttctcagtacagcagggaatgttccacctcaccagtgacaacagggactgagtcatgtcatcaagagtctcaaggttttaagtgaaattattcctctggctcataaaacaattacaattcagttttgtgttgtatggattgtggattttttcaggtcaccagttattcctagtcactgaaagaatctgtgactctattgtgctcatttgcacgtagcaattagtgaaataatgaaacaatagtaattttcagagtctaatagagtttctgtcttttggactgtctgctgggcaccaaatttcatacttcacaccctttctaagtctattctttcaagagcacatgaaacaaaaaatatgttcatagcctccaaaatctatgcccatgtgaaaatatccactgcataaggagctctgtggttggaatgcacagaatcctaactagccatgtcactgtgggagcactttatacttaggattcacgtgcatcttcttggaccaaaaaagcttcagtgtttcactgactatatctctctgaaaagtctctttcaaagactttcactttctttcaactatcgaactcttttgatgcacgttttcacactgaacttgttctgtgattcccactgctttcttagactttttctattgctccataggagctcttttttcttccctttctccaaacaagacatcttctatgacttattactatgtttacagatatccctgtttgggataaattcctttaagtcactaggaattttccattcttaaggaaacccatgaaggcagagcaattagtgatctgagttagtacataattttcctgtggatatcttgcacgatccctgacagtcctggatagttggcagtcggcaatttcttccctctgaccaagtgaagaatttctgtcagtgtgaacgaagctggcagttaccacggagtgactgaaagcagaactatgtctacagttggtgtgactccagcatggctggatgaagtgagttcattacataaatcagcttacaaccagcttaccggttgcttaaagtgcagccatgaggttaaaagggaatggttgaaaagtggccttaaaacgtgggatttcttgttgccatagtttaagtaattcttcctgatgacagaagggtatgaagatctacaatagcttgaattttaaggtaaatggatatctgtgttttcaattggtttcaagttccttttttactctagtttaataagaaattaaggtgctgagaaacccacctttcacttcattgtctttaccaaagctggcagtagctttatcactctcggagggttgaattcaacccttaacaccatttagggtcggtacaataggaaccaactgctgaagtgcactggacctggccctgtggtgctgtactgctgaactgtgggactctgaagtaagcagcccagagttttatattctgatttgagag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]