GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 01:05:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_019612125            6269 bp    mRNA    linear   VRT 18-NOV-2019
DEFINITION  PREDICTED: Meleagris gallopavo ATPase copper transporting beta
            (ATP7B), transcript variant X3, mRNA.
ACCESSION   XM_019612125
VERSION     XM_019612125.2
DBLINK      BioProject: PRJNA62397
KEYWORDS    RefSeq.
SOURCE      Meleagris gallopavo (turkey)
  ORGANISM  Meleagris gallopavo
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Meleagridinae; Meleagris.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_015011.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 18, 2019 this sequence version replaced XM_019612125.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Meleagris gallopavo Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6269
                     /organism="Meleagris gallopavo"
                     /mol_type="mRNA"
                     /isolate="NT-WF06-2002-E0010"
                     /db_xref="taxon:9103"
                     /chromosome="1"
                     /sex="female"
                     /tissue_type="blood"
                     /breed="Aviagen turkey brand Nicholas breeding stock"
                     /note="donated by Nicholas Turkey Breeding Farms"
     gene            1..6269
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 38 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:100541545"
     CDS             182..4792
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_019467670.1"
                     /db_xref="GeneID:100541545"
                     /translation="
MERKLDNKMRRELSCLATLNNKNITLVSIRKQQAAHDVPELLIIGEGSKAGSLLEASSNLQKEEKVLQRNSMGMPEVNTTGRQVLSNADSPPSCALEPEMKQNFAFDNMGYEETFEAMPSSSSQERTVAVNVVGMTCQSCVQSIEGRISKVKGVVSIKVSLELNNALVKYLQSEISPEQICQEIEDMGFDANVAEERLTPVSVNLPCSREAVMKLRIEGMTCQSCVTSIEGKIKKLHGVAKIKVSLSNQEAVIAYHPYIIQPEELRSHISNLGYDCTIKSKSAPLKLGVLDVRNLQSADPKKTPASLESEGLHPLIANNSSTATVTVHIEGMHCKSCVRNIEGNISSLPGIQSIEVSLEHKCAVVQYSPNLITLPALQQAIESLPPGNFKVCLPNTSEANNQASPSPALVCDLFREPLKDTMCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLADKTGTIHYDPANTNGEELRAAIEEMGFDASLLTDIGAGEYKHCPDASSTAAQPRVPEPPHQGCVSDALPDSPHPDEPNQPSGATAKKCFLQVTGMTCASCVSTIERNLQKEEGIVSVLVALMAGKAEIKYKPDLIQPLEIAQLIQNLGFEATVIEDHSEIEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEGIGFHASVSRRVPNTHNLDHRKEIQQWRKSFLCSLVFGIPVLILMIYMLIPGGEHHGAMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYIQAYKSLKHKAANMDVLIVLATTIAYVYSCVILLVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHTIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDIIQKYFPNQNKHLSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVVGMAEEGVDKLDANKSGDSSAPVGDDTLITLSESNGSSSSHTYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNERRRVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRCASVLQNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRSAPWDQISQVSLSSLTSDKLPRQNGFFEEEGDKWSLLMNGGDEEQYI"
     misc_feature    569..754
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(584..592,599..601)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    821..1012
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(839..847,854..856)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1166..1333
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1175..1183,1190..1192)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1457..1648
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1475..1483,1490..1492)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1826..2014
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1841..1849,1856..1858)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2051..2242
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2069..2077,2084..2086)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2306..4465
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3299..3301,3305..3307,4394..4396)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3431..3439,3641..3643,3827..3835,3923..3925,
                     4043..4051,4109..4111,4118..4120,4127..4129,4184..4186,
                     4193..4195)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
gtgtacacaaagatcacaggttacatctgggatttcattatgcatgcctaatgagcacattgatgagaactccccaggcccttgtaaaagtagctgaaaaaagagctgctgataaggcactgaatagcttctctcctaaagctttcctttggagttgagatatttaaagccggcaaagataatggagagaaaattggacaataaaatgcgaagggagctgtcctgcctagctactttgaacaacaaaaacataaccctggtgtccattcgaaagcagcaggcagctcacgatgtgcctgaactactgattattggtgaagggtccaaagcagggtctctgctagaagcaagcagcaacttgcagaaagaagagaaagttttgcagcgtaactccatgggaatgccagaagtcaatacaactggaaggcaggttttgtccaatgctgactctcctcctagctgtgcgctggaacctgaaatgaaacagaattttgcttttgacaacatgggctacgaggagacctttgaagccatgccctcatcatcttcccaggaacgcactgttgcagtcaatgttgtgggaatgacttgtcaatcttgtgtgcagtcgatagaaggacgaatttccaaagttaagggtgttgtgagtattaaagtctcccttgaactgaataatgctttagtaaaatatctacagtcagaaataagccctgaacagatttgccaagaaatagaggatatgggctttgacgccaatgtagcagaagaaaggttgacaccagtatctgtaaatttgccatgctcgagagaagcagtaatgaagcttcggatagaaggcatgacgtgccagtcctgcgtcaccagcattgaaggaaagattaagaagcttcacggtgtggcaaaaatcaaggtgtcactcagtaaccaggaagcagttattgcttaccatccttacatcattcagcctgaggaacttaggagccacatcagtaacctggggtacgactgcaccattaagagtaaatcagcacctttgaagcttggtgtgcttgatgtcaggaacctgcagagtgcagaccccaagaagacaccagcatctctcgagagtgagggtttgcatccgctgattgccaacaacagcagcacagctacagtgactgtacatatagaaggcatgcactgcaaatcttgtgtcagaaacattgaaggaaatatatcctctcttccaggcatacaaagtattgaagtctccttggagcataaatgtgctgttgtacagtatagccccaatttaattaccttgcctgctttgcagcaagctattgaatcccttccacctggaaactttaaagtttgcctccctaatacttcagaagcaaataaccaggcatctccatctcctgctttggtatgtgatctcttcagagagccactgaaagacacaatgtgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaaggaacaatatctcagagacaaggtgtgcagcatgtagcagtttctttagctgacaagactgggaccatacattatgatccagcaaacacgaatggtgaggagttgagagctgccatagaagaaatggggtttgatgcatctttgctgacagatattggtgcaggagaatacaagcattgccctgatgccagtagcaccgcagcgcagcctcgagtcccagagcctcctcaccagggttgtgtctccgatgcacttccagacagccctcaccctgatgagccaaaccaacccagcggagcaacagccaagaagtgttttttacaagtcactggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagaaggtattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagcctgacttgatacagcctcttgaaatagcacagttgatccagaatttgggttttgaagccactgtcatagaagatcattcagaaatagaaggaaatgtggagctgcttattacggggatgacttgtgcctcctgtgttcacaatattgaatccaaacttatgagaacaaacggcatattctacgcctcagttgctcttgctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagatattataaaaataattgagggaattggctttcatgcttctgtgtctagaagagttccaaatacacataacttggatcacagaaaggaaatacagcagtggaggaagtcttttttgtgcagccttgtgtttggtattcctgtcttaatcctaatgatttatatgctaatacctggcggcgaacaccacggggctatggtgctggagcagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacatacaagcttacaagtcactgaagcacaaggcagccaatatggatgtgcttatcgtactggccacaacaattgcttacgtgtattcatgtgtgatcctgttggtggcaataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccaatgctgtttgtattcattgcccttgggagatggcttgaacatatagcaaagagtaagacctcagaagctcttgctaaacttatatctctccaagccacggaagccactgtggtgactcttggacctgaccacactatcatcagagaggagcaggtacctgttgaactggttcaaaggggtgatattgtaaaggttgttccaggtggaaagttcccagtggatgggaaggtcattgaaggcaattctatggcagacgagtctctcattactggggaagctatgcctgtcactaaaaagcctgggagcacagtgattgctggctctataaatgcacatggctcagttcttgttaacgcaactcatgttggtaatgataccaccctggcacagatagtgaaattggtggaagaagctcaaatgtcaaaggcaccaatccagcaactggcagataagtttagtggatattttgttccatttatcatcataatttctacagtgactttgatagtatggatcacaattggttttataaattttgatattattcagaaatattttcctaatcagaacaagcacctttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctaccccaacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggcggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaacggggaccattacttgtggagtccctaaagtcatgagggttcttctgctgggagacacagccgtgctctctctgaagaaggtactggcagtggtcggcactgcagaagccagcagtgagcatcctttaggagtggcggtcactaaatactgcaaagaggagcttggaactcagagcctgggatactgcaccaacttccaggcagtcccaggttgtggcatcagctgcaaagtaggtggtgttgaggctgtcgtgggcatggctgaggagggtgttgataagttggacgctaacaagagtggggacagcagtgctcctgtgggagatgacacactgatcacactttctgaatcgaatggttcatcatcttcccacacatactcagtattgattggaaatcgtgagtggatgcgacggaatggcttgcacattgcaaatgatgtcaatgatgccatgacagaccatgaaactaaaggacagacagccatattagtggctatagatggtgccttatgtggaatgattgcaatcgcagacactgtcaagcaggaggcagccctggctgtgcacacactgaaaaacatgggaatagatgtagtgctgataacgggcgacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaagaactccaaaatgagaggagaagggttgcgatggttggtgacggagtcaatgattcccctgcgctagccagggccgacattggaattgcaattggaacgggtaccgatgttgccattgaagcagcagatgttgttcttatccgatgcgcttctgtcttacagaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagtgaggagaatacgaataaatctgattcttgccttaatttataatctgcttggaataccaatagcagcaggtgtgttcatgcctgctggtcttgtgcttcagccttggatgggatcagctgccatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagctcaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagatcggctccttgggatcaaattagtcaagtttctctctcttccttgacttcagacaagctcccgagacaaaatgggttttttgaggaggaaggggacaagtggtcactgctgatgaatggaggagatgaagaacagtacatctgaagtgttgtgttctcagtacagcagggaatgttccacctcaccagtgacaacagggactgagtcatgtcatcaagagtctcaaggttttaagtgaaattattcctctggctcataaaacaattacaattcagttttgtgttgtatggattgtggattttttcaggtcaccagttattcctagtcactgaaagaatctgtgactctattgtgctcatttgcacgtagcaattagtgaaataatgaaacaatagtaattttcagagtctaatagagtttctgtcttttggactgtctgctgggcaccaaatttcatacttcacaccctttctaagtctattctttcaagagcacatgaaacaaaaaatatgttcatagcctccaaaatctatgcccatgtgaaaatatccactgcataaggagctctgtggttggaatgcacagaatcctaactagccatgtcactgtgggagcactttatacttaggattcacgtgcatcttcttggaccaaaaaagcttcagtgtttcactgactatatctctctgaaaagtctctttcaaagactttcactttctttcaactatcgaactcttttgatgcacgttttcacactgaacttgttctgtgattcccactgctttcttagactttttctattgctccataggagctcttttttcttccctttctccaaacaagacatcttctatgacttattactatgtttacagatatccctgtttgggataaattcctttaagtcactaggaattttccattcttaaggaaacccatgaaggcagagcaattagtgatctgagttagtacataattttcctgtggatatcttgcacgatccctgacagtcctggatagttggcagtcggcaatttcttccctctgaccaagtgaagaatttctgtcagtgtgaacgaagctggcagttaccacggagtgactgaaagcagaactatgtctacagttggtgtgactccagcatggctggatgaagtgagttcattacataaatcagcttacaaccagcttaccggttgcttaaagtgcagccatgaggttaaaagggaatggttgaaaagtggccttaaaacgtgggatttcttgttgccatagtttaagtaattcttcctgatgacagaagggtatgaagatctacaatagcttgaattttaaggtaaatggatatctgtgttttcaattggtttcaagttccttttttactctagtttaataagaaattaaggtgctgagaaacccacctttcacttcattgtctttaccaaagctggcagtagctttatcactctcggagggttgaattcaacccttaacaccatttagggtcggtacaataggaaccaactgctgaagtgcactggacctggccctgtggtgctgtactgctgaactgtgggactctgaagtaagcagcccagagttttatattctgatttgagag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]