GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 09:32:02, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_019525163            6647 bp    mRNA    linear   VRT 16-DEC-2016
DEFINITION  PREDICTED: Gavialis gangeticus ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_019525163
VERSION     XM_019525163.1
DBLINK      BioProject: PRJNA357062
KEYWORDS    RefSeq.
SOURCE      Gavialis gangeticus (Gharial)
  ORGANISM  Gavialis gangeticus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Crocodylia; Longirostres; Gavialidae;
            Gavialinae; Gavialis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017729032.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Gavialis gangeticus Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6647
                     /organism="Gavialis gangeticus"
                     /mol_type="mRNA"
                     /isolate="Ggan-Ray"
                     /db_xref="taxon:94835"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
     gene            1..6647
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 28 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109303096"
     CDS             284..4894
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_019380708.1"
                     /db_xref="GeneID:109303096"
                     /translation="
MERISDHNLKWEKSSLATLNSNSITLVAVRKQQPATDVPELLIVSEKSKPGSPVKVHSSFQKEERVSQGCSMGVSEVKAEQALPKTSTPASCVRKPTMKQNFAFDNIGYEGNSENLSSGSSQMDIVTVNILGMTCQSCVHSVEGRISKVKGIVSIKVSLERSNAVLKYIRSEISPIQICQEIEDMGFDACIAEGKSIPSSLRSTTSIAEAVVKFRVEGMTCQSCVNTIEGTVGKLHGVTRIKVSLSNQEAVILYQPFIVQPEDLKKHINNLGYESTIKTKLAPLTLGRIDLEGLQKVAAGLNSGYVDPLVDKMNNTATVTLGIEGIHCTSCIKNIEGNISKFPGLQCIKVSLEHKNAVVQFNPNLITLSSLQQSIETLPPGNFRVSFLNGAEANNGELLSKAASSSHCFLSKCFGDQLPITTVIGIGGMSCSSCVQSIEGTISQRKGVQQVSVSLAERTGTIQYDSTVTSSEELRTAIEDMGFDASILTETATRNCNDPTISEPAEIQHKALESTCQRVGNIPEPSHRSYVSNTPPKISFLEAPKRPSILTTEKCFMQIAGMTCASCVSTIERHLQKEDGIVSVLVALMAGKAEIKYKPESIQPLEIAQLIQNLGFDATVIEDQADEEGRVELVITGMTCASCVHNIESKLTKTNGILYASVALATCKAHVQFDPEIIGPRDIIKIIENLGFQASLAKRDPNDHNLDHKKEIRQWRKSFLWSLIFGIPVLILMIYMLIPAGQGSGVLEQNLIPGLSLLNLLFFVLCTFVQFLGGWYFYVQAYKSLKHRTANMDVLIVLATTIAYIYSCVILIVAMAEKAEQSPITFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPNHSVIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVKATHVGPDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWIAMGFINFEVVQKFFPHRSKNISKAEIIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLGDTDTLSLKVVLAVVGTAEANSEHPLGMAITKYCKEELGTESLGYCMDFQAVPGCGISCKVSGVEAVLGQKEHSLNERNADLHGDGTVSLKHSSLIMISEPDGAAAPHTYLVVIGNREWMRRNGLHISNDVNDAMTGHEMKGQTAVLVAMDGALCGMIAIADTVKQEAALAVHTLKTMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALAQADIGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGCMKPLTPSQISVHIGMDDRRRDLPRTSAWDQISQVSLSSLTSDKLSRHSGSIEEEGDKWSLLINDRDEEQYI"
     misc_feature    662..850
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(680..688,695..697)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    920..1111
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(938..946,953..955)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1241..1411
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1259..1267,1274..1276)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1559..1741
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1568..1576,1583..1585)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1952..2140
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1967..1975,1982..1984)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2177..2368
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2195..2203,2210..2212)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2432..4567
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3419..3421,3425..3427,4496..4498)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3551..3559,3761..3763,3947..3955,4043..4045,
                     4163..4171,4229..4231,4238..4240,4247..4249,4304..4306,
                     4313..4315)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    3551..3571
                     /gene="ATP7B"
                     /note="P-type ATPase signature motif; other site"
                     /db_xref="CDD:319783"
     misc_feature    3551..3553
                     /gene="ATP7B"
                     /note="phosphorylation site [posttranslational
                     modification]"
                     /db_xref="CDD:319783"
ORIGIN      
agatcagtagtgttgaatgcagtttagtgagtgcaagggatggcagttggtgggaactatttaaactgggtgcaagtgtgaagaggtgagtgcagtgtgcagctacttataaagcacatggattaaaattgggacctcggcgtgggtgcgtagggagggcacgctgacttaaaagtgacagcagttttcaagctgtcctaggattgttgtgcttttaatacttggaacaacgtctcttggtaaggtctgtttggtgttacagcacttgaagccgggaaagaaaatggagagaatatcagaccataatttgaaatgggagaagtcctctctggctactttaaacagcaacagcataaccctggtggctgttcgtaagcagcagccagctaccgatgtgcctgaactactgattgtcagtgaaaagtccaagccaggatctcctgtaaaggtgcacagcagttttcagaaagaagagagagtttcacagggttgctccatgggggtatcagaagtcaaggctgagcaggctttgcctaagactagtacccctgcaagttgtgtacggaagccaacaatgaagcagaattttgcctttgacaacattggctatgaagggaactctgaaaacctgtcctctgggtcatctcaaatggacatcgttacagtcaacattctgggtatgacgtgccaatcttgtgtgcactctgtagagggcagaatttccaaggtgaagggcattgtgagtattaaggtctctcttgagcgcagcaatgctgtgcttaaatacatacggtcagaaataagtcccatacagatttgccaggaaattgaggacatgggttttgatgcctgcatagcagaaggaaaatctatcccatcatctttaagatcaacaacgtctatagcagaagctgtagttaagtttcgggtagaaggcatgacctgccagtcttgtgtcaataccattgaaggtacagttgggaaactacatggtgtgacaagaataaaagtctccctgagtaatcaagaagcagtcattctttatcagcctttcattgttcaacctgaagaccttaagaagcacataaataacctggggtatgaaagcactattaagaccaaattagccccactaacgcttggtaggattgatttagaaggcttacagaaggttgcagctggccttaacagtggttatgtggatccgttggtggacaagatgaataatacggcaactgtgactctagggatagaaggcatccattgcacatcttgcatcaaaaatattgaaggaaatatatcaaagtttccaggcctacaatgtattaaagtgtcactggagcataaaaatgctgttgtacagtttaaccctaacttaattaccttatcatctttacaacaatccattgaaacccttccgcctggtaactttagagtatccttccttaatggagcagaagcaaacaatggagagcttttatcaaaggcagcatcttcatcccattgttttctcagcaagtgctttggagatcaactgcctatcacaactgtaattggcattggtggaatgagctgcagttcctgtgtacagtctattgaaggcacgatatcccaaaggaaaggagtacaacaagtatcagtttctttagctgaaaggacggggaccatacagtatgattcaactgtaactagttctgaagagctaagaactgctatagaagacatgggatttgatgcttctattctaacagagaccgctacaagaaactgcaatgatccaactatttctgagcctgctgaaatacaacataaagctctggagtcaacttgccaaagagtgggaaatattcctgaaccctctcatcgaagttatgtctcaaatactccaccaaagatctctttcctagaggctccaaaacggcccagtatactgacaactgagaagtgctttatgcagatcgcgggcatgacttgtgcatcatgtgtatcaaccattgaaagacatctacaaaaggaagatggtattgtttcagtgcttgtagctttgatggcaggtaaagcagagataaaatacaagccagagagcatacagcctcttgaaatagcacagctaatccagaatttgggcttcgatgctacagtcatagaagatcaggctgatgaagaagggagagtggagcttgttattacagggatgacttgtgcttcctgcgtccacaacattgaatccaaactaactaaaactaatggcattttatatgcttcagtggcacttgcaacttgcaaagctcatgtccagtttgatcctgaaattattggacctcgagatattataaaaattatagagaacctcggctttcaggcttccttggccaagagggatccaaatgatcataacttggatcataaaaaggaaataagacaatggagaaagtcttttttatggagcctaatatttggtatacctgtcttaatcttaatgatatatatgttaataccggctggccaaggatctggggtcctggaacagaatctcattcctggattgtctctcttaaatcttctcttctttgtcttgtgcacttttgttcaattccttggtggatggtatttctatgtgcaagcctacaaatcactgaagcacagaacagctaatatggatgtactcatagtgctggccacaacaattgcttatatatactcttgtgtgatcttaatagtagctatggctgaaaaggcagagcaaagccccatcacgttttttgacacaccacccatgctatttgtcttcattgctcttgggagatggctggaacacatagcaaagagtaaaacatcggaagcacttgctaaactaatatctcttcaagctacagaagctactgtggtgactcttggacccaaccactctgtcatcagggaggagcaggtgcctgttgagttggttcagcggggtgacattgtaaaggttgttcctggtggaaagttcccagttgatggaaaagttattgaaggcacctctatggcagatgaatctcttattactggggaggccatgcccgtcactaaaaaacctggcagcacagtgattgcaggatctataaatgcacatggctctgttcttgttaaggcaactcatgttggccctgacactaccctggcacaaattgtaaaattggtggaagaagctcagatgtccaaggcaccaattcagcaactggctgataagtttagtggctattttgttccatttatcatcataatttcaacagtaacattgattgtgtggattgcaatgggctttatcaatttcgaagttgttcagaaattcttcccacatcggagcaaaaacatctctaaagctgaaataatcatcaggtttgcattccaaacttctatcactgtgctgtgcattgcgtgcccctgttccttgggcctggccactccaacagcagtcatggtgggcacaggagtggctgctcaaaatggtattcttatcaaaggtggaaaacctctggagatggcccacaagataaagactgtgatgtttgataaaacggggaccatcacccatggagttcctaaagtcatgagagtgcttctgctaggggacacggataccctgtctctcaaggtggttcttgcagttgtgggcactgcagaggccaacagtgaacatcccttgggaatggctataactaaatactgcaaagaggaacttggtacagagagcctggggtattgcatggattttcaggcagtaccaggctgtggaatcagctgtaaagtcagtggtgttgaagctgtcttaggccagaaggagcacagtctaaatgagcggaatgctgacctgcatggggacggcactgtttccctgaaacacagttcattgatcatgatatccgaacctgatggtgcagcagcccctcacacctacttagtggtgattggaaatcgtgaatggatgagacgtaacggtttgcatatttcaaatgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagctgtattggtggctatggacggtgcattgtgtgggatgattgcaatagcagatactgtcaaacaggaagcagcactggctgtgcacaccctaaaaaccatgggaatcgatgtggttcttataacaggggacaacagaaaaactgctaaagccattgctacacaggttggcataaaaaaagtgtttgctgaggttcttccttctcacaaagtcgcaaaggtccaggaactccaaaatgaagggaagaaggtagccatggttggagatggagtcaatgattcccctgcactggcccaggctgacatcggtgttgctattggaacaggcactgacgttgccattgaagcagcagatgttgttcttattagaaatgatttactggacgtggttgccagcattcatctatcaaagagaactgtacgaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacccatagcagcaggagtgtttatgcccattggtatcgtgcttcagccatggatgggttccgcagccatggcagcttcatcagtgtctgtggtgctatcttccttgcaactaaagtgttacaagaaaccagatgcagaaagttatgaagcccaagctcagggctgtatgaagccactgactccttctcaaatcagtgttcacattgggatggatgataggagacgggatttgcccagaaccagtgcctgggatcagattagtcaagtgtccctctcttctctgacttcagacaagctgtctagacacagtggctctatagaggaagaaggggacaagtggtcactgctcattaatgacagagatgaagaacaatacatttaacatgcatctccaagagctagatagtaaggtgagatacagttctttgccagtgacagcaatgactaaaccaccaagagtttgataattacaaatggattcttttatgtttcatcttgcaaagcaactggagttcaataagtcagctttgtattgtgtgaatgttgatttgtcaggctacaaatcactttcagtcactaaaatgtcttgaggccccgtaatgaattaagcccttaactgcatacattattcactatgcacagtatgatattggaactttcaaagtctaacataactgctacctcctgggttgtttgtggggaaccaaaatcccattcttctctatctcactcatgtgtcttacagtgattcctgtaagaaacatagacactttccccatatgccatatttcattactatgtcaaagtgaaaacaaatgtgcttgacttagagccctgtgtttagggatcttggatcttgttcttggataaaataaaaaaaatcagaacaagctgtgccaacacaggggaaattttacagtttggactgtccttttccttagagtcaaaatatgtatttaaagattttccagagcataaatattttgaaattctgttttaaaggttatcatttaactccatgcattgctgattcttttgacattgatctccatttactaaatttcctctcagtacctaactgctctacttagatgttccacttgaatcctgcagcccttttcttccagcagagttccacttctccacatttcttacatgttccattttcccctgtgggaccagatcttacaagccagtagagacccctctgtccttctgaaatctgtgaagtctgagctcccttcagttgtctgcactagtaaaacactttatctgcaagcacagtgcagaatcctttgattctctgaaaaatgtggtgctcagctatttgtctgtgtggcagggcgctgtaaatacacaattgtgaaccatcctagctgttcagctattgacatattcgtgctgctgcattcagagaggctttccatcatgagtgcttgttctgtgctctgatttgagcacagaatgatgctcttgcaccaatgagagaagttaataagtgtggctctttgggaactttacagaagtgatagtgcagtagaagtggagattcaatgagcacagtggatctggagactggcaagcaaaaagtagtagtttaaagtgcatctataaatccacttaatccctcttaatatcttgtgccagagctgagtagttaaaagaaaccctttgcctgaatagtaatcctgtcccaggcaaaagaaaaagtttcattcttatacgcatcacaccaggttaaatctgtcagtcttacttcaaatttcagtttaacagtggacctaataactaaatatgtccacaaggaggagacagtaacttgactggtataatgggctaggccagctattcctgggattccaaaatgacgggtgggaatcatggggaaaaggtattgagcttaattgtactttgtatgtgtggttgactggttgtttggggtttttgaatcgtgcaggatgacaatgcaatttgtgggtcagttacatgaaaaagcagtaaaaatgaaaagagtaaagaataggtacagggcacccattcactatggcagcacaagtattcaattattcttcaaagctgttcttaaccatttaatcacacgtttaaagtacttctttgaaggacagaagagggga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]