LOCUS       XM_019474841            4287 bp    mRNA    linear   VRT 05-DEC-2016
DEFINITION  PREDICTED: Aptenodytes forsteri ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_019474841
VERSION     XM_019474841.1
DBLINK      BioProject: PRJNA261081
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Aptenodytes forsteri (emperor penguin)
  ORGANISM  Aptenodytes forsteri
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Sphenisciformes; Spheniscidae;
            Aptenodytes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008794446.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Aptenodytes forsteri Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..4287
                     /organism="Aptenodytes forsteri"
                     /mol_type="mRNA"
                     /isolate="BGI_AS27"
                     /db_xref="taxon:9233"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="Antarctica"
     gene            1..4287
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 11 Proteins, and 2% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:103907912"
     CDS             1..4287
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_019330386.1"
                     /db_xref="GeneID:103907912"
                     /translation="

MKHNFAFDNMGYEESFETAPSPSSQEHTVAVSVVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTATVNLSCLREAVVKLQVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYACTIKSKSAPLKLGVLDLRRLQNANPNETPASLESDGMDPPVAKMSGTATVAVRIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKRAVVQYNPNLITLSALQQAIESLPPGNFKVCLLNGSEVDKGASPSPALLCDLFREPLQDTTCTAVIRIDGMTCNSCVQSIEGTISQRQGVQCIAVSLADRTGSIHYDPAVTNGEELRAAIEDMGFDASVLTDTAAEECRHQPDASNAAVQPRAPEPSRQGCASDALPDSPHLDGPNQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATIIEDHAESEGNVELLITGMTCASCVHNIESKLLRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPGAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGAPKVMRVLLLGDPAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVRGVEAILGMAEEGLDKLDTNRSRNSSAPMGDNALITFSKSHASHTYLVLIGNREWMRRNGLHIANDINDAMTDHEMKGQTAILVAINGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRMNLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLTSDKLPRHNGFVEEEEDKWSLLMNGGDEEQYI"

     misc_feature    91..276
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(106..114,121..123)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    343..534
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(361..369,376..378)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    682..855
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(697..705,712..714)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    979..1170
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(997..1005,1012..1014)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1348..1536
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1363..1371,1378..1380)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1573..1764
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1591..1599,1606..1608)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1828..3960
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2821..2823,2827..2829,3889..3891)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2953..2961,3163..3165,3340..3348,3436..3438,
                     3556..3564,3622..3624,3631..3633,3640..3642,3697..3699,
                     3706..3708)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

atgaaacacaattttgcttttgacaacatgggctatgaggagagctttgaaactgcaccctctccatcttcccaagaacacactgtggcagtcagtgttgtgggaatgacttgccaatcttgtgtgcagtcaatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacagaacaacgctgtaataaagtatctgcagtcagaaataagtcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgacaacagcaaccgtaaatttgtcgtgcttgagagaagcagtagttaagcttcaggtagaaggcatgacatgccagtcctgcgtcaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgacgacctcaagagccatatcagtaacttggggtatgcatgcaccattaaaagtaagtcagcccctctgaagcttggtgtcctcgatctcaggcgcctgcagaatgcaaaccccaatgagacaccagcaagtctcgagagtgatgggatggatccaccggtcgccaagatgagtggcacagctacggtggctgtacggatagaaggcatgcactgcaaatcctgtgtcagaaacattgaaggaaatatatcagatcttcccggcatacaaagtattaaagtgtctttggagcataaacgtgctgtggtacagtataacccaaatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtatgtctccttaatggttcggaagttgataagggagcatctccatcacctgctttgctgtgtgatctcttcagagagccgctgcaagacacgacatgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaagggaccatatcacagagacaaggagtgcaatgtatagcagtttctctagctgacagaactgggagcatacattatgatccagctgtcactaatggagaagagttaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatactgccgctgaagaatgtaggcaccagcctgacgccagtaatgctgctgtgcaacctcgagctccagagccttctcgccaaggctgtgcctcggatgctcttccagacagtcctcaccttgatgggccaaaccagcccagcggagcgacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcgtcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatagaagatcatgcagaatcagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcctgagaacaaatgggatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttccgtggctagaagagttccaggtgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgacggtgagcaccatgggtctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacgtgcaagcttacaaatcactgaagcacaaaacggccaatatggatgtgctcatcgtactggccacaacgattgcttatgtgtattcgtgtgtgatcctgatggtagcgataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccgatgctgtttgtgttcattgcccttgggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccggtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcatcactggggaagctatgccagtcactaaaaagcctggaagcacggtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaattttgatgttattcaaaaatattttcctaatcagaacaaacacgtttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctacccccacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgcggagctcctaaagtcatgagggtgcttttgctgggagacccagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggcactcagagcctgggatactgcaccgacttccaggcagtcccgggctgtggcatcagctgcaaagtcagaggtgttgaggccatcctgggcatggccgaggagggtctcgataagctggacactaacaggagcaggaacagcagtgctcccatgggagataacgcactgatcacgttctccaaatcacatgcttctcatacatacttggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcgatgacagatcatgaaatgaaaggacagactgccatactagtggctataaatggcatgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacacactgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaacggcgaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaggtccaggagctccaaaatgggaggaggaaggttgcgatggttggtgatggagtcaatgattcccctgcactagccagggctgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaatgacttactggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaatgaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcaaccttggatgggatcagctgcaatggcagcttcttctgtgtctgttgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccggctccttgggatcagattagccaagtgtctctctcttccttgacttcagacaagctgccgagacataatggttttgttgaggaggaagaggacaagtggtcattgctcatgaatggaggagatgaagaacagtacatctga

//