2024-05-04 00:43:00, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018882803 591 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Yet3p (YET3), partial mRNA. ACCESSION XM_018882803 VERSION XM_018882803.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 591) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 591) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 591) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031672). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..591 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="A" gene <1..>591 /gene="YET3" /locus_tag="AWJ20_835" /db_xref="GeneID:30037911" CDS 1..591 /gene="YET3" /locus_tag="AWJ20_835" /inference="similar to AA sequence:KEGG_Orthology:K14009" /note="hypothetical protein; YET3 null mutant decreases the level of secreted invertase; homolog of human BAP31 protein; protein abundance increases in response to DNA replication stress; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA,IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 11914276]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 20378542]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA,IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_function: GO:0003674 - molecular_function [Evidence ND]; GO_process: GO:0008150 - biological_process [Evidence ND]; GO_process: GO:0006886 - intracellular protein transport [Evidence IEA]; GO_process: GO:0015031 - protein transport [Evidence IEA]; GO_process: GO:0006810 - transport [Evidence IEA]; GO_process: GO:0016192 - vesicle-mediated transport [Evidence IEA]" /codon_start=1 /product="Yet3p" /protein_id="XP_018735055.1" /db_xref="GeneID:30037911" /translation="
MGAFLFLVTPLPRAYRKKVLTALSGLPFAHHLAITLRFTFIFILILFIDSVNRVYRVQVEVAEAHSSIRAAGNMISVERSEIQARKFYSQRNMYLCGFTLFLSLILNRTHALVLDLMEAQDKISALKGSSNDSVKAETLATEQKSEIARLEKELARKDQDLQTLKKQSEALSKEYHSVSDQLNAKSGSVPSDKKLD"
misc_feature 1..378 /gene="YET3" /locus_tag="AWJ20_835" /note="B-cell receptor-associated protein 31-like; Region: Bap31; pfam05529" /db_xref="CDD:428511" misc_feature 433..582 /gene="YET3" /locus_tag="AWJ20_835" /note="Bap31/Bap29 cytoplasmic coiled-coil domain; Region: Bap31_Bap29_C; pfam18035" /db_xref="CDD:436226" ORIGIN
atgggagcattcctattcttggttacaccgttacctcgagcttatcgtaagaaggtattgactgctttatccggtctgccttttgctcaccacttagcgataaccttgagatttacttttatattcatactgatcctatttattgattcggtcaatcgagtgtacagagttcaagtcgaagttgccgaagctcacagttccattcgcgctgcggggaacatgatctctgtagaaagatctgagattcaggctcgcaagttctattcccaaagaaacatgtatttgtgtggcttcaccctgtttctatcattgattttaaacagaactcatgctcttgttcttgatttaatggaagctcaagacaaaatttctgctctcaagggaagctctaatgattccgtcaaagctgaaactcttgccactgaacaaaagtcagagattgctcgtcttgaaaaagagttggctcgtaaagaccaggatttgcaaactctgaagaagcagtctgaggcgctgtccaaagaatatcatagcgtcagtgatcaattgaatgctaagagtggttcagtaccttctgataagaaactagattag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]