LOCUS       XM_018882133             549 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Orm1p (ORM1), partial mRNA.
ACCESSION   XM_018882133
VERSION     XM_018882133.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 549)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 549)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 549)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..549
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="A"
     gene            <1..>549
                     /gene="ORM1"
                     /locus_tag="AWJ20_502"
                     /db_xref="GeneID:30037216"
     CDS             1..549
                     /gene="ORM1"
                     /locus_tag="AWJ20_502"
                     /note="Protein that mediates sphingolipid homeostasis;
                     evolutionarily conserved, required for resistance to
                     agents that induce unfolded protein response; Orm1p and
                     Orm2p together control membrane biogenesis by coordinating
                     lipid homeostasis with protein quality control; ORM1 has a
                     paralog, ORM2, that arose from the whole genome
                     duplication; GO_component: GO:0035339 - SPOTS complex
                     [Evidence IDA] [PMID 20182505]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IEA]; GO_component:
                     GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID
                     14562095]; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IDA] [PMID 20182505]; GO_component:
                     GO:0005789 - endoplasmic reticulum membrane [Evidence
                     IEA]; GO_component: GO:0016021 - integral component of
                     membrane [Evidence IEA,IEA]; GO_component: GO:0016021 -
                     integral component of membrane [Evidence ISM] [PMID
                     12192589]; GO_component: GO:0016020 - membrane [Evidence
                     IEA]; GO_function: GO:0003674 - molecular_function
                     [Evidence ND]; GO_process: GO:0090156 - cellular
                     sphingolipid homeostasis [Evidence IMP] [PMID 20182505];
                     GO_process: GO:0090155 - negative regulation of
                     sphingolipid biosynthetic process [Evidence IGI,IMP,IPI]
                     [PMID 20182505]; GO_process: GO:0006986 - response to
                     unfolded protein [Evidence IMP,ISS] [PMID 12093374]"
                     /codon_start=1
                     /product="Orm1p"
                     /protein_id="XP_018734730.1"
                     /db_xref="GeneID:30037216"
                     /translation="

MSSLSPNPPKDRRRRSSSIIGHLEPETIEERSDQSSSPNLNASWVNNKGAWVVHVVIIALLLIFYDLIPGVTSELSWTLTNITYVTGSYVMFHYVTGVPFEFNAGAYDSLTMWEQIDDGDQYTPAKKFLLGVPIGLFLISTHYTHYDITMFIVNCVFCLISVIPKLPSSHRLRITVPGMSET"

     misc_feature    34..540
                     /gene="ORM1"
                     /locus_tag="AWJ20_502"
                     /note="Predicted membrane protein [Function unknown];
                     Region: COG5081"
                     /db_xref="CDD:227413"
ORIGIN      

atgtcatcactttcaccaaatccccctaaagacagaaggagaagatcctcgtcgattattggccacttagagcccgagactattgaagaacggtcagatcagtcgtcttcccctaatttaaacgcctcgtgggtcaataataaaggcgcctgggtagtccacgtagtgattattgccctattattgatcttctacgatttaatacctggagtgacttcggaattatcgtggactctgacaaatatcacctatgtcactggatcttatgtcatgttccactatgtgacgggagttccttttgagttcaatgctggtgcttacgattctctgaccatgtgggagcaaatcgacgacggcgaccaatacacacctgccaagaagttcttgctcggagtgccaattggcctgttcttgatctctacacactatacacactacgacatcactatgttcattgtcaactgcgtattctgcttgatctcggtcattcccaagctgccatcaagccaccgactccgaatcacagtgcccggaatgtcggagacctga

//