2024-05-04 14:03:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018882133 549 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Orm1p (ORM1), partial mRNA. ACCESSION XM_018882133 VERSION XM_018882133.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 549) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 549) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 549) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031672). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..549 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="A" gene <1..>549 /gene="ORM1" /locus_tag="AWJ20_502" /db_xref="GeneID:30037216" CDS 1..549 /gene="ORM1" /locus_tag="AWJ20_502" /note="Protein that mediates sphingolipid homeostasis; evolutionarily conserved, required for resistance to agents that induce unfolded protein response; Orm1p and Orm2p together control membrane biogenesis by coordinating lipid homeostasis with protein quality control; ORM1 has a paralog, ORM2, that arose from the whole genome duplication; GO_component: GO:0035339 - SPOTS complex [Evidence IDA] [PMID 20182505]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 14562095]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 20182505]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA,IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_function: GO:0003674 - molecular_function [Evidence ND]; GO_process: GO:0090156 - cellular sphingolipid homeostasis [Evidence IMP] [PMID 20182505]; GO_process: GO:0090155 - negative regulation of sphingolipid biosynthetic process [Evidence IGI,IMP,IPI] [PMID 20182505]; GO_process: GO:0006986 - response to unfolded protein [Evidence IMP,ISS] [PMID 12093374]" /codon_start=1 /product="Orm1p" /protein_id="XP_018734730.1" /db_xref="GeneID:30037216" /translation="
MSSLSPNPPKDRRRRSSSIIGHLEPETIEERSDQSSSPNLNASWVNNKGAWVVHVVIIALLLIFYDLIPGVTSELSWTLTNITYVTGSYVMFHYVTGVPFEFNAGAYDSLTMWEQIDDGDQYTPAKKFLLGVPIGLFLISTHYTHYDITMFIVNCVFCLISVIPKLPSSHRLRITVPGMSET"
misc_feature 34..540 /gene="ORM1" /locus_tag="AWJ20_502" /note="Predicted membrane protein [Function unknown]; Region: COG5081" /db_xref="CDD:227413" ORIGIN
atgtcatcactttcaccaaatccccctaaagacagaaggagaagatcctcgtcgattattggccacttagagcccgagactattgaagaacggtcagatcagtcgtcttcccctaatttaaacgcctcgtgggtcaataataaaggcgcctgggtagtccacgtagtgattattgccctattattgatcttctacgatttaatacctggagtgacttcggaattatcgtggactctgacaaatatcacctatgtcactggatcttatgtcatgttccactatgtgacgggagttccttttgagttcaatgctggtgcttacgattctctgaccatgtgggagcaaatcgacgacggcgaccaatacacacctgccaagaagttcttgctcggagtgccaattggcctgttcttgatctctacacactatacacactacgacatcactatgttcattgtcaactgcgtattctgcttgatctcggtcattcccaagctgccatcaagccaccgactccgaatcacagtgcccggaatgtcggagacctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]