LOCUS       XM_018881183            1977 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Aim14p (AIM14), partial mRNA.
ACCESSION   XM_018881183
VERSION     XM_018881183.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 1977)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1977)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1977)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031671).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1977
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="C"
     gene            <1..>1977
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /db_xref="GeneID:30036223"
     CDS             1..1977
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="NADPH oxidase localized to the perinuclear ER;
                     produces superoxide from NADPH; overexpression causes MCA1
                     dependent apoptosis; likely involved in
                     superoxide-mediated regulation of the actin cytoskeleton;
                     member of a conserved superfamily of NADPH oxidases (NOX
                     enzymes); has similarity to iron/copper reductases
                     (FRE1-8), particularly Fre8p; GO_component: GO:0016021 -
                     integral component of membrane [Evidence IEA];
                     GO_component: GO:0016021 - integral component of membrane
                     [Evidence ISM] [PMID 10341420]; GO_component: GO:0016021 -
                     integral component of membrane [Evidence ISM] [PMID
                     12192589]; GO_component: GO:0016020 - membrane [Evidence
                     IEA,IEA]; GO_component: GO:0097038 - perinuclear
                     endoplasmic reticulum [Evidence IDA] [PMID 22586098];
                     GO_component: GO:0005840 - ribosome [Evidence IDA] [PMID
                     16702403]; GO_function: GO:0000293 - ferric-chelate
                     reductase activity [Evidence IMP] [PMID 22586098];
                     GO_function: GO:0016491 - oxidoreductase activity
                     [Evidence IEA,IEA]; GO_function: GO:0016722 -
                     oxidoreductase activity, oxidizing metal ions [Evidence
                     ISA] [PMID 10341420]; GO_function: GO:0016175 -
                     superoxide-generating NADPH oxidase activity [Evidence
                     IMP] [PMID 22586098]; GO_process: GO:0006915 - apoptotic
                     process [Evidence IGI] [PMID 22586098]; GO_process:
                     GO:0006811 - ion transport [Evidence IEA]; GO_process:
                     GO:0055114 - oxidation-reduction process [Evidence
                     IEA,IEA]; GO_process: GO:0032956 - regulation of actin
                     cytoskeleton organization [Evidence IMP] [PMID 22586098]"
                     /codon_start=1
                     /product="Aim14p"
                     /protein_id="XP_018733798.1"
                     /db_xref="GeneID:30036223"
                     /translation="

MDAVVLSVLQARHEGHHDEVPSPVIPGGNAHHGAHYANITYGYILVLISIIGMVWISVTNTINIRSAGAGVSGLTGGISGLSRKLSDISLRGFRLGHLLSKPSPRLVLLPLWILVVALLSLTGGATGSLNGLAKRLGRITFAIVPLILFLSLKPSPLPNTYYVKLLTFHKWIARSAVLTGSLHGILYTAYFIRQGTTVKILKVDNLLGVVLLLGFLVVFITSLRPIRTRYYRLFYALHYPLAWVFLIIASFHARPGVGFLALWSAFILLGQAFYRVFTSRTIRIIENYQVSPTLYSVTLPRDIMPDYFPAGSHIRLGKRSLWSPLSWLEPTHPYTIASLSSDEANIRLLIRKTNFTIQNGVHYTISGPFASRIAQELSPSTSSSSDGGADSGVGYKAVGDGARKVVVFAGGSGLSFAAPLVRELSSMGIAYRLIWITRDKTDLKALELLEISAADVYITGNNPNSSSNVYSDILDRGNEFNLNLSSGLSALKSVSSAAATVASGGRTRGVNTSTTGYNDYEEEIEFDELVESDPELSSSTSTHDDDDTPLEPATPSDASSSSSSSNNTRSKRRSNTNLSDTSRANTNFNSTKPPTSSFARITITYGRPDFSQSTSTFILPGQQRSSWAIACGPKQLVHDVETWATANHISFSGEKYFL"

     misc_feature    406..747
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="Ferric reductase like transmembrane component;
                     Region: Ferric_reduct; pfam01794"
                     /db_xref="CDD:426438"
     misc_feature    889..1380
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="NADPH oxidase (NOX) catalyzes the generation of
                     reactive oxygen species (ROS) such as superoxide and
                     hydrogen peroxide. ROS were originally identified as
                     bactericidal agents in phagocytes, but are now also
                     implicated in cell signaling and metabolism. NOX...;
                     Region: NOX_Duox_like_FAD_NADP; cd06186"
                     /db_xref="CDD:99783"
     misc_feature    order(937..939,994..1005,1045..1053,1063..1068,1234..1236)
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="FAD binding pocket [chemical binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(994..996,1000..1005)
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="FAD binding motif [chemical binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    1219..1251
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="NAD pyrophosphate binding region [chemical
                     binding]; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1219..1221,1231..1242,1246..1248)
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="beta-alpha-beta stucture motif; other site"
                     /db_xref="CDD:99783"
     misc_feature    order(1300..1305,1312..1314)
                     /gene="AIM14"
                     /locus_tag="AWJ20_4125"
                     /note="NADP ribose binding motif [chemical binding]; other
                     site"
                     /db_xref="CDD:99783"
ORIGIN      

atggacgcggtggtgctgagtgtgctgcaagcgcgacacgaggggcatcacgacgaggtgcccagtcctgtcattcccggtggaaacgcccatcatggcgctcactatgctaatatcacttatgggtacattcttgtgctgatatctataattggcatggtatggataagtgtcacgaacactataaacatcaggtcagccggagcaggcgtgtctgggttgactggaggaatttcaggtctgtcaaggaagctgtcggacatttcgctaaggggattcagacttggtcatttactctccaaaccatctcctagattagtccttttgccattatggatcctggtagtggctttattatcacttactggtggagctacagggtcactgaatggactggcaaaacggttgggaagaattacgttcgcaatagtaccgctgattctgttcttgtcactcaaaccgtcaccattacctaatacatattatgtcaagctactgacttttcataaatggatcgctagaagtgctgtattaacaggctcgctccatgggatcctgtacacagcatactttattagacagggaaccacagtcaagatcctcaaagtggataatttactgggagtagtgttactactagggtttttggtggtgtttattacttcgttaagacctattcgaacaagatactatagactattttacgcgctccattatccattggcatgggttttcttgataatagccagtttccatgctcgtccaggagttgggtttctagctctttggtcggcatttatcctgctgggccaggccttttatagagtgtttacctcacgaacaattcgcatcattgaaaactatcaggtatcaccaaccctgtattcagtcacgcttccacgagatataatgcctgattacttcccagcaggttcgcatattagactgggtaaacgaagtctgtggtcacctttgtcatggcttgagcctactcatccgtataccattgcatctctgtcatcagacgaggccaatatcagacttttgatccggaaaacaaacttcactattcaaaatggagttcattatacgatttcaggaccgtttgcgagcaggatagctcaagagctcagtccatccaccagttccagttcggatggtggtgctgattcgggtgttgggtataaagcagtaggagatggagctcgtaaagtagtagtatttgctgggggttcaggactgtcatttgcagcaccacttgttcgtgaactgagttccatgggtattgcctaccgtcttatctggataacccgtgacaaaactgatctcaaggctctcgaactgcttgaaatcagtgctgccgatgtgtatatcacaggtaataaccccaacagctcttctaacgtctacagcgacattctggaccgtggtaatgagttcaacttgaacctttcttctggtctttcagcactgaaatcagtctcttcagcagcagccactgttgctagcggaggtcgaactcgcggtgtcaataccagcacgactggatacaatgactatgaagaagaaatagaattcgatgagctcgtggaatcagaccctgaactttcgtcatcaacctcgactcatgacgacgacgacactccactggaacctgccacccccagcgacgccagctcgtcgtcctcttcatccaacaacacacgatccaaacgacgatctaacaccaacctctccgataccagccgagcaaacaccaacttcaactcgacaaaaccccctacaagctcgtttgctcgaatcacaattacctacggccgacccgacttctcccaatccacaagcacattcatacttcccggccaacaacgctcctcctgggccatagcctgcggtcccaaacagctcgtccacgacgtcgagacctgggccactgccaaccacatttccttctccggcgaaaagtacttcctataa

//