GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 05:55:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018880661             645 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans peptidylprolyl isomerase family protein
            CPR5 (CPR5), partial mRNA.
ACCESSION   XM_018880661
VERSION     XM_018880661.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 645)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 645)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 645)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031674).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..645
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="B"
     gene            <1..>645
                     /gene="CPR5"
                     /locus_tag="AWJ20_3630"
                     /db_xref="GeneID:30035674"
     CDS             1..645
                     /gene="CPR5"
                     /locus_tag="AWJ20_3630"
                     /inference="similar to AA sequence:KEGG_Orthology:K03768"
                     /note="Peptidyl-prolyl cis-trans isomerase (cyclophilin)
                     of the ER; catalyzes the cis-trans isomerization of
                     peptide bonds N-terminal to proline residues;
                     transcriptionally induced in response to unfolded proteins
                     in the ER; CPR5 has a paralog, CPR2, that arose from the
                     whole genome duplication; GO_component: GO:0005737 -
                     cytoplasm [Evidence IDA] [PMID 11914276]; GO_component:
                     GO:0005783 - endoplasmic reticulum [Evidence IEA];
                     GO_component: GO:0005783 - endoplasmic reticulum [Evidence
                     IDA] [PMID 11914276]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IDA] [PMID 8377189];
                     GO_component: GO:0005788 - endoplasmic reticulum lumen
                     [Evidence IEA]; GO_function: GO:0016853 - isomerase
                     activity [Evidence IEA]; GO_function: GO:0042277 - peptide
                     binding [Evidence IEA]; GO_function: GO:0003755 -
                     peptidyl-prolyl cis-trans isomerase activity [Evidence
                     IEA,IEA,IEA]; GO_function: GO:0003755 - peptidyl-prolyl
                     cis-trans isomerase activity [Evidence ISS] [PMID
                     8377189]; GO_process: GO:0008150 - biological_process
                     [Evidence ND]; GO_process: GO:0006457 - protein folding
                     [Evidence IEA,IEA]; GO_process: GO:0000413 - protein
                     peptidyl-prolyl isomerization [Evidence IEA,IEA,IEA]"
                     /codon_start=1
                     /product="peptidylprolyl isomerase family protein CPR5"
                     /protein_id="XP_018738458.1"
                     /db_xref="GeneID:30035674"
                     /translation="
MKLLWTVFAVILGFVLYASNVFAASGAGEQVSPVITHKVYFDIKQGNEELGRIIFGLYGEVVPKTVENFRSLAAGDKGFGYKGSSFHRVIKQFMIQGGDFTNGDGTGGKSIYGSKFEDENFTLKHSKPGLLSMANAGRNTNGSQFFITTVVTSWLDGKHVVFGEVLDGMDIVKKIENTKTGWGDRPSIAITIADSGEIASIPTGEEAENVHEDL"
     misc_feature    109..588
                     /gene="CPR5"
                     /locus_tag="AWJ20_3630"
                     /note="Cyclophilin A, B and H-like cyclophilin-type
                     peptidylprolyl cis- trans isomerase (PPIase) domain. This
                     family represents the archetypal cystolic cyclophilin
                     similar to human cyclophilins A, B and H. PPIase is an
                     enzyme which accelerates protein folding...; Region:
                     cyclophilin_ABH_like; cd01926"
                     /db_xref="CDD:238907"
     misc_feature    order(259..264,277..279,430..432,436..438,460..462)
                     /gene="CPR5"
                     /locus_tag="AWJ20_3630"
                     /note="active site"
                     /db_xref="CDD:238907"
ORIGIN      
atgaagcttctttggactgttttcgcagtcattcttggatttgtgctttacgcctccaacgtttttgcagcttctggagctggagagcaggtttctcctgtcatcactcacaaagtttactttgatattaagcagggcaatgaagaacttggccgaattattttcggtttgtatggtgaggttgtccccaaaaccgttgagaatttccggtccttagctgctggagataaaggttttggatacaaaggctccagtttccacagagttatcaagcaattcatgattcaaggtggtgacttcaccaatggagatggtactggtggcaagtctatttacggaagcaagtttgaggatgagaactttactctcaagcacagcaaaccaggtttgttatcaatggccaatgctggtcgtaataccaatggctctcaattcttcattactactgtcgtcacctcttggttagatggtaagcatgttgtcttcggcgaagttttggatggtatggatattgtcaaaaagattgagaataccaagactggttggggtgaccgtccatcaattgctatcaccattgctgattctggtgagattgcctcgattcccactggcgaagaggccgaaaacgtccatgaggacctgtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]