GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 14:14:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018880185            1206 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Nsg2p (NSG2), partial mRNA.
ACCESSION   XM_018880185
VERSION     XM_018880185.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 1206)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1206)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1206)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031674).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1206
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="B"
     gene            <1..>1206
                     /gene="NSG2"
                     /locus_tag="AWJ20_3180"
                     /db_xref="GeneID:30035174"
     CDS             1..1206
                     /gene="NSG2"
                     /locus_tag="AWJ20_3180"
                     /note="Protein involved in regulation of sterol
                     biosynthesis; specifically stabilizes Hmg2p, one of two
                     HMG-CoA isoenzymes that catalyze the rate-limiting step in
                     sterol biosynthesis; homolog of mammalian INSIG proteins;
                     NSG2 has a paralog, NSG1, that arose from the whole genome
                     duplication; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IEA]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IDA] [PMID 14562095];
                     GO_component: GO:0005789 - endoplasmic reticulum membrane
                     [Evidence IEA]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence IEA]; GO_component:
                     GO:0016020 - membrane [Evidence IEA]; GO_function:
                     GO:0051082 - unfolded protein binding [Evidence IMP] [PMID
                     16270032]; GO_process: GO:0016126 - sterol biosynthetic
                     process [Evidence IGI] [PMID 16270032]"
                     /codon_start=1
                     /product="Nsg2p"
                     /protein_id="XP_018738029.1"
                     /db_xref="GeneID:30035174"
                     /translation="
MATPPRDTRRVNGSSSNSGHNGSLNGQINGSVNGSVNGTINGSVNVNGTSNSSSPAAASPYSNGLSSNKSFLNLTTSALAGVFGSQVSLAELNGDVSNAPSRVQTPVGRDRATRGIDEFSDKTAFYNGINGRVNGRDKLQSGINKLNRRKGNSPGGRVSPSIPSLSAADDEDETDEDVSGSSRGNSSSVTYSLPGVPLSAPTLAVRLALLFGFGVAYGQLSKQLHDNHFVTEHTLDIDHTGFFSLIWGFQGILLGFLLPLFDWLFPEQRKRLHGKGGADWSSIVRAVAAFMGVAYGIRKIAWTSTMQAAFYWGMVNPCLWFILDATRNGFILSTLVATVGTFVFALIFPDHLPERYTLAGSVSENYLSVVALVASVFFCCSICFGNLGRRLLSVETSRARR"
     misc_feature    613..1173
                     /gene="NSG2"
                     /locus_tag="AWJ20_3180"
                     /note="Insulin-induced protein (INSIG); Region: INSIG;
                     pfam07281"
                     /db_xref="CDD:429380"
ORIGIN      
atggctactcctcctagagatactagacgggttaatggatccagttccaacagcggacataacgggtcgttgaatggacaaatcaatgggtcagttaatggatcagttaatggaactattaacggatctgtcaatgtgaatggcaccagcaatagctcgagcccagccgccgcttctccctacagtaatggactttccagtaacaaatcgtttctcaatttaaccacatcagctttagccggagtattcgggtcacaagtctcgttagcagagttgaatggagatgtgtccaacgcgccatctcgtgttcagacacctgttggacgagaccgtgccaccaggggtattgacgagttctccgacaaaaccgctttttacaacggaatcaacggtcgcgtcaatggccgtgataaacttcaaagtggaattaacaaattaaatagacgcaagggcaattctcctggcggcagagtctcaccatccatcccgtcattatcagcagcagacgacgaggacgagacggatgaagatgtatcgggatcttcaagaggcaattcctcttctgtaacatactcactaccaggagttccattatcagcacctaccctggctgtccgattagctcttttattcggattcggcgtggcctatggccaattgtcgaaacaattacacgataatcattttgtcactgaacatacccttgacattgaccacacgggtttcttctcgttgatctgggggttccaaggtattcttcttgggtttttgttaccactttttgactggttgttccccgaacaacgcaaacgacttcacggaaaaggcggagccgactggtcgtccattgtacgagcagttgctgcgtttatgggcgtggcttatggcattcgtaaaattgcctggacctcaacaatgcaagcagctttctactggggaatggtcaacccgtgtctgtggttcattctcgatgccacccgtaacgggttcattctgtcgaccctcgtcgccacggtcggcacctttgtcttcgcactcatcttccctgaccacctgcccgaacgatacacactcgcgggatcggtctctgagaactatttatcggtagtagcgctcgtggcgagcgtcttcttctgctgtagcatatgcttcggcaacctgggccgccgtcttctctccgtagaaacctctcgcgccagacgatag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]