2024-05-04 14:14:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018880185 1206 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Nsg2p (NSG2), partial mRNA. ACCESSION XM_018880185 VERSION XM_018880185.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 1206) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 1206) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1206) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031674). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1206 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="B" gene <1..>1206 /gene="NSG2" /locus_tag="AWJ20_3180" /db_xref="GeneID:30035174" CDS 1..1206 /gene="NSG2" /locus_tag="AWJ20_3180" /note="Protein involved in regulation of sterol biosynthesis; specifically stabilizes Hmg2p, one of two HMG-CoA isoenzymes that catalyze the rate-limiting step in sterol biosynthesis; homolog of mammalian INSIG proteins; NSG2 has a paralog, NSG1, that arose from the whole genome duplication; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 14562095]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_function: GO:0051082 - unfolded protein binding [Evidence IMP] [PMID 16270032]; GO_process: GO:0016126 - sterol biosynthetic process [Evidence IGI] [PMID 16270032]" /codon_start=1 /product="Nsg2p" /protein_id="XP_018738029.1" /db_xref="GeneID:30035174" /translation="
MATPPRDTRRVNGSSSNSGHNGSLNGQINGSVNGSVNGTINGSVNVNGTSNSSSPAAASPYSNGLSSNKSFLNLTTSALAGVFGSQVSLAELNGDVSNAPSRVQTPVGRDRATRGIDEFSDKTAFYNGINGRVNGRDKLQSGINKLNRRKGNSPGGRVSPSIPSLSAADDEDETDEDVSGSSRGNSSSVTYSLPGVPLSAPTLAVRLALLFGFGVAYGQLSKQLHDNHFVTEHTLDIDHTGFFSLIWGFQGILLGFLLPLFDWLFPEQRKRLHGKGGADWSSIVRAVAAFMGVAYGIRKIAWTSTMQAAFYWGMVNPCLWFILDATRNGFILSTLVATVGTFVFALIFPDHLPERYTLAGSVSENYLSVVALVASVFFCCSICFGNLGRRLLSVETSRARR"
misc_feature 613..1173 /gene="NSG2" /locus_tag="AWJ20_3180" /note="Insulin-induced protein (INSIG); Region: INSIG; pfam07281" /db_xref="CDD:429380" ORIGIN
atggctactcctcctagagatactagacgggttaatggatccagttccaacagcggacataacgggtcgttgaatggacaaatcaatgggtcagttaatggatcagttaatggaactattaacggatctgtcaatgtgaatggcaccagcaatagctcgagcccagccgccgcttctccctacagtaatggactttccagtaacaaatcgtttctcaatttaaccacatcagctttagccggagtattcgggtcacaagtctcgttagcagagttgaatggagatgtgtccaacgcgccatctcgtgttcagacacctgttggacgagaccgtgccaccaggggtattgacgagttctccgacaaaaccgctttttacaacggaatcaacggtcgcgtcaatggccgtgataaacttcaaagtggaattaacaaattaaatagacgcaagggcaattctcctggcggcagagtctcaccatccatcccgtcattatcagcagcagacgacgaggacgagacggatgaagatgtatcgggatcttcaagaggcaattcctcttctgtaacatactcactaccaggagttccattatcagcacctaccctggctgtccgattagctcttttattcggattcggcgtggcctatggccaattgtcgaaacaattacacgataatcattttgtcactgaacatacccttgacattgaccacacgggtttcttctcgttgatctgggggttccaaggtattcttcttgggtttttgttaccactttttgactggttgttccccgaacaacgcaaacgacttcacggaaaaggcggagccgactggtcgtccattgtacgagcagttgctgcgtttatgggcgtggcttatggcattcgtaaaattgcctggacctcaacaatgcaagcagctttctactggggaatggtcaacccgtgtctgtggttcattctcgatgccacccgtaacgggttcattctgtcgaccctcgtcgccacggtcggcacctttgtcttcgcactcatcttccctgaccacctgcccgaacgatacacactcgcgggatcggtctctgagaactatttatcggtagtagcgctcgtggcgagcgtcttcttctgctgtagcatatgcttcggcaacctgggccgccgtcttctctccgtagaaacctctcgcgccagacgatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]