LOCUS       XM_018879594             942 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Nuc1p (NUC1), partial mRNA.
ACCESSION   XM_018879594
VERSION     XM_018879594.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 942)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 942)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 942)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031674).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..942
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="B"
     gene            <1..>942
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /db_xref="GeneID:30034572"
     CDS             1..942
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /inference="similar to AA sequence:KEGG_Orthology:K01173"
                     /note="Major mitochondrial nuclease; has RNAse and DNA
                     endo- and exonucleolytic activities; roles in
                     mitochondrial recombination, apoptosis and maintenance of
                     polyploidy; involved in fragmentation of genomic DNA
                     during PND (programmed nuclear destruction); encodes
                     ortholog of mammalian endoG; GO_component: GO:0016020 -
                     membrane [Evidence IEA]; GO_component: GO:0005743 -
                     mitochondrial inner membrane [Evidence IEA,IEA];
                     GO_component: GO:0005743 - mitochondrial inner membrane
                     [Evidence IDA] [PMID 17244531]; GO_component: GO:0005743 -
                     mitochondrial inner membrane [Evidence IDA] [PMID
                     3286639]; GO_component: GO:0005739 - mitochondrion
                     [Evidence IEA]; GO_component: GO:0005739 - mitochondrion
                     [Evidence IDA] [PMID 16823961]; GO_component: GO:0005634 -
                     nucleus [Evidence IDA] [PMID 17244531]; GO_function:
                     GO:0004520 - endodeoxyribonuclease activity [Evidence IDA]
                     [PMID 3286639]; GO_function: GO:0004519 - endonuclease
                     activity [Evidence IEA]; GO_function: GO:0004529 -
                     exodeoxyribonuclease activity [Evidence IDA] [PMID
                     3286639]; GO_function: GO:0016787 - hydrolase activity
                     [Evidence IEA,IEA]; GO_function: GO:0046872 - metal ion
                     binding [Evidence IEA,IEA]; GO_function: GO:0004518 -
                     nuclease activity [Evidence IEA]; GO_function: GO:0003676
                     - nucleic acid binding [Evidence IEA]; GO_function:
                     GO:0004540 - ribonuclease activity [Evidence IDA] [PMID
                     3286639]; GO_process: GO:0006308 - DNA catabolic process
                     [Evidence IDA] [PMID 3286639]; GO_process: GO:0006310 -
                     DNA recombination [Evidence IMP] [PMID 8087883];
                     GO_process: GO:0006401 - RNA catabolic process [Evidence
                     IDA] [PMID 3286639]; GO_process: GO:0006309 - apoptotic
                     DNA fragmentation [Evidence IMP] [PMID 22727375];
                     GO_process: GO:0006915 - apoptotic process [Evidence IMP]
                     [PMID 17244531]"
                     /codon_start=1
                     /product="Nuc1p"
                     /protein_id="XP_018737496.1"
                     /db_xref="GeneID:30034572"
                     /translation="

MLWGKKTETTTTTNTSEVVGTIPLTPELSRAGAVVRSSLVNPAEYFQKYGFPGPVHDIASREQFISCYDRKTRNPAWVIEHITGQSLKVRDGDRGSSIFKEDTAVPALFRGQLRDYFRSGYDRGHQAPAADAKFSQNAMDETFFLTNMCPQVGDGFNRDYWAHFEHFCRKLTDSYASVRIVTGPLYLPKKDSDGKWRVSYEVIGNPPNIAVPTHFFKIIVGENPSPALGSPKGVAIGAFVLPNEKIDNNTPLKSFYVPIESVERSTGVEFLPLLPASERRDLCREVKCEITVREFVKALPAPREQLALPPPRK"

     misc_feature    181..831
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /note="DNA/RNA non-specific endonuclease; Region: NUC;
                     smart00477"
                     /db_xref="CDD:214683"
     misc_feature    order(364..369,373..375,469..471,493..495,505..507)
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /note="active site"
                     /db_xref="CDD:238043"
     misc_feature    order(364..369,505..507)
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:238043"
     misc_feature    469..471
                     /gene="NUC1"
                     /locus_tag="AWJ20_2639"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238043"
ORIGIN      

atgttgtggggtaaaaagaccgagactactaccactacgaacacttcggaggtggtggggaccattccattgactccagaactgtcccgggctggtgcagtagtgagatcgtcgttggtaaacccggcagagtattttcagaagtatggatttcctggaccagtgcacgatattgccagcagagaacagtttattagttgttatgaccgtaaaactcgcaatccagcatgggtaattgaacatattacgggacagtctttaaaggttcgagacggagatcgtggttcgagcatttttaaggaggatactgcagtaccagctctattccgcggtcagttacgagactatttccgcagtggttacgaccgtggccatcaggctccagctgctgatgctaaattttctcaaaatgccatggatgagaccttttttcttactaatatgtgtcctcaagtgggtgatgggttcaatcgtgactattgggctcattttgagcatttttgtcgtaagctcactgattcctatgcatcagtacgtattgttactggaccactttatttgcctaagaaggacagtgacggaaaatggcgtgtcagttatgaggtaattggaaatcctccaaatattgcagtacctacccatttttttaagatcattgtcggtgagaacccgtctcccgcattaggatcccccaagggagtcgcaattggcgcgtttgttcttcctaacgagaaaattgataacaacactccattaaagagcttttatgttcccattgagtctgttgagaggtcgacgggtgtggagttcctgccattactaccagcatccgaacgccgtgatctgtgtcgcgaggttaagtgtgaaatcactgtccgcgaatttgtaaaggcacttccggctccacgagaacaacttgctctgcctccaccaagaaaataa

//