2024-05-04 10:55:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018878691 603 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Spt14p (SPT14), partial mRNA. ACCESSION XM_018878691 VERSION XM_018878691.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 603) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 603) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 603) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031672). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..603 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="A" gene <1..>603 /gene="SPT14" /locus_tag="AWJ20_1785" /db_xref="GeneID:30033625" CDS 1..603 /gene="SPT14" /locus_tag="AWJ20_1785" /inference="similar to AA sequence:KEGG_Orthology:K03857" /note="UDP-glycosyltransferase subunit of the GPI-GnT complex; UDP-GlcNAc-binding and catalytic subunit of the enzyme that mediates the first step in glycosylphosphatidylinositol (GPI) biosynthesis, mutations cause defects in transcription and in biogenesis of cell wall proteins; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IMP] [PMID 9079905]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0000506 - glycosylphosphatidylinositol-N- acetylglucosaminyltransferase (GPI-GnT) complex [Evidence TAS] [PMID 11102867]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_function: GO:0008194 - UDP-glycosyltransferase activity [Evidence ISS] [PMID 10970797]; GO_function: GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO_function: GO:0016740 - transferase activity [Evidence IEA]; GO_function: GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO_process: GO:0006506 - GPI anchor biosynthetic process [Evidence IEA,IEA,IEA]; GO_process: GO:0006506 - GPI anchor biosynthetic process [Evidence ISS] [PMID 8081362]; GO_process: GO:0009058 - biosynthetic process [Evidence IEA]" /codon_start=1 /product="Spt14p" /protein_id="XP_018735969.1" /db_xref="GeneID:30033625" /translation="
MREKFRLQERVDLIGSIRHEMVREVMVSGHIYLHPTLTEAFGTVIVEAASCGLLVVTTKVGGIPEVLPSHMTVFASPSEDSLVDSTLHAISLIENKRIDTYLFHEEIKGMYCWEDVAERTEAVYDHISKTVRDDEPLVERLQKYYRCGPWAGKLFVVCIIVDTLFYLFLQWFWPEELIDRAKKWPKKIVNCDLTESQKKD"
misc_feature <1..477 /gene="SPT14" /locus_tag="AWJ20_1785" /note="glycosyltransferase family 1 and related proteins with GTB topology; Region: Glycosyltransferase_GTB-type; cl10013" /db_xref="CDD:447877" ORIGIN
atgagggaaaagtttcgcttacaggaaagagtagatttaataggaagtattcgacatgaaatggttcgggaggtcatggtttctggtcatatttacttgcatcctactttaacagaagcatttggcaccgtgattgttgaagctgcttcttgtggactattagttgtcacaactaaagtaggaggaattcccgaagtgctaccttcccatatgactgtattcgcgtccccgtctgaagactcgttggtagacagtacacttcatgcgatatctttgattgaaaacaaaagaatagatacctatctcttccatgaagagattaagggtatgtactgttgggaagacgtagcggaaagaactgaggcggtgtatgatcatataagcaagaccgtaagggatgacgagccattggtagagaggctgcagaaatattatcgttgtggcccatgggcaggaaagctctttgtcgtctgcattatcgttgatactttgttttacttatttcttcagtggttctggcccgaagagcttattgacagagctaagaaatggccgaaaaaaattgtgaactgtgacttgactgaatcccagaaaaaagattaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]