GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 10:55:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018878691             603 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Spt14p (SPT14), partial mRNA.
ACCESSION   XM_018878691
VERSION     XM_018878691.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 603)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 603)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 603)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..603
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="A"
     gene            <1..>603
                     /gene="SPT14"
                     /locus_tag="AWJ20_1785"
                     /db_xref="GeneID:30033625"
     CDS             1..603
                     /gene="SPT14"
                     /locus_tag="AWJ20_1785"
                     /inference="similar to AA sequence:KEGG_Orthology:K03857"
                     /note="UDP-glycosyltransferase subunit of the GPI-GnT
                     complex; UDP-GlcNAc-binding and catalytic subunit of the
                     enzyme that mediates the first step in
                     glycosylphosphatidylinositol (GPI) biosynthesis, mutations
                     cause defects in transcription and in biogenesis of cell
                     wall proteins; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IEA]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IMP] [PMID 9079905];
                     GO_component: GO:0005789 - endoplasmic reticulum membrane
                     [Evidence IEA]; GO_component: GO:0000506 -
                     glycosylphosphatidylinositol-N-
                     acetylglucosaminyltransferase (GPI-GnT) complex [Evidence
                     TAS] [PMID 11102867]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence IEA]; GO_component:
                     GO:0016020 - membrane [Evidence IEA]; GO_function:
                     GO:0008194 - UDP-glycosyltransferase activity [Evidence
                     ISS] [PMID 10970797]; GO_function: GO:0017176 -
                     phosphatidylinositol N-acetylglucosaminyltransferase
                     activity [Evidence IEA]; GO_function: GO:0016740 -
                     transferase activity [Evidence IEA]; GO_function:
                     GO:0016757 - transferase activity, transferring glycosyl
                     groups [Evidence IEA]; GO_process: GO:0006506 - GPI anchor
                     biosynthetic process [Evidence IEA,IEA,IEA]; GO_process:
                     GO:0006506 - GPI anchor biosynthetic process [Evidence
                     ISS] [PMID 8081362]; GO_process: GO:0009058 - biosynthetic
                     process [Evidence IEA]"
                     /codon_start=1
                     /product="Spt14p"
                     /protein_id="XP_018735969.1"
                     /db_xref="GeneID:30033625"
                     /translation="
MREKFRLQERVDLIGSIRHEMVREVMVSGHIYLHPTLTEAFGTVIVEAASCGLLVVTTKVGGIPEVLPSHMTVFASPSEDSLVDSTLHAISLIENKRIDTYLFHEEIKGMYCWEDVAERTEAVYDHISKTVRDDEPLVERLQKYYRCGPWAGKLFVVCIIVDTLFYLFLQWFWPEELIDRAKKWPKKIVNCDLTESQKKD"
     misc_feature    <1..477
                     /gene="SPT14"
                     /locus_tag="AWJ20_1785"
                     /note="glycosyltransferase family 1 and related proteins
                     with GTB topology; Region: Glycosyltransferase_GTB-type;
                     cl10013"
                     /db_xref="CDD:447877"
ORIGIN      
atgagggaaaagtttcgcttacaggaaagagtagatttaataggaagtattcgacatgaaatggttcgggaggtcatggtttctggtcatatttacttgcatcctactttaacagaagcatttggcaccgtgattgttgaagctgcttcttgtggactattagttgtcacaactaaagtaggaggaattcccgaagtgctaccttcccatatgactgtattcgcgtccccgtctgaagactcgttggtagacagtacacttcatgcgatatctttgattgaaaacaaaagaatagatacctatctcttccatgaagagattaagggtatgtactgttgggaagacgtagcggaaagaactgaggcggtgtatgatcatataagcaagaccgtaagggatgacgagccattggtagagaggctgcagaaatattatcgttgtggcccatgggcaggaaagctctttgtcgtctgcattatcgttgatactttgttttacttatttcttcagtggttctggcccgaagagcttattgacagagctaagaaatggccgaaaaaaattgtgaactgtgacttgactgaatcccagaaaaaagattaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]