LOCUS       XM_018878509            1269 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Rny1p (RNY1), partial mRNA.
ACCESSION   XM_018878509
VERSION     XM_018878509.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Trichomonascaceae;
            Sugiyamaella.
REFERENCE   1  (bases 1 to 1269)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1269)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1269)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1269
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="A"
     gene            <1..>1269
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /db_xref="GeneID:30033436"
     CDS             1..1269
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /inference="similar to AA sequence:KEGG_Orthology:K01166"
                     /note="Vacuolar RNase of the T(2) family; relocalizes to
                     the cytosol where it cleaves tRNAs upon oxidative or
                     stationary phase stress; promotes apoptosis under stress
                     conditions and this function is independent of its
                     catalytic activity; GO_component: GO:0005737 - cytoplasm
                     [Evidence IEA,IEA]; GO_component: GO:0005829 - cytosol
                     [Evidence IDA] [PMID 19332891]; GO_component: GO:0005576 -
                     extracellular region [Evidence IDA] [PMID 11158587];
                     GO_component: GO:0000324 - fungal-type vacuole [Evidence
                     IDA] [PMID 24102742]; GO_component: GO:0005775 - vacuolar
                     lumen [Evidence IEA]; GO_component: GO:0005773 - vacuole
                     [Evidence IEA]; GO_component: GO:0005773 - vacuole
                     [Evidence IDA] [PMID 19332891]; GO_function: GO:0003723 -
                     RNA binding [Evidence IEA]; GO_function: GO:0004519 -
                     endonuclease activity [Evidence IEA]; GO_function:
                     GO:0004521 - endoribonuclease activity [Evidence IDA]
                     [PMID 11158587]; GO_function: GO:0004521 -
                     endoribonuclease activity [Evidence IMP] [PMID 19332891];
                     GO_function: GO:0016787 - hydrolase activity [Evidence
                     IEA]; GO_function: GO:0004518 - nuclease activity
                     [Evidence IEA]; GO_function: GO:0033897 - ribonuclease T2
                     activity [Evidence IEA,IEA]; GO_process: GO:0006401 - RNA
                     catabolic process [Evidence IMP] [PMID 19332891];
                     GO_process: GO:0090502 - RNA phosphodiester bond
                     hydrolysis, endonucleolytic [Evidence IEA,IEA];
                     GO_process: GO:0006915 - apoptotic process [Evidence IGI]
                     [PMID 19332891]; GO_process: GO:0000902 - cell
                     morphogenesis [Evidence IMP] [PMID 11158587]; GO_process:
                     GO:0090305 - nucleic acid phosphodiester bond hydrolysis
                     [Evidence IEA]"
                     /codon_start=1
                     /product="Rny1p"
                     /protein_id="XP_018735805.1"
                     /db_xref="GeneID:30033436"
                     /translation="

MLGRPLAFSVGLASLATCVQGIAIDIEGYGRDQLVFAPVTGFESPVRIASDHESCPIDAPLSCSTESVKDSCCYEGTNGLFLSTQFWDYYPPTGPDDVFTLHGLWNDKCNGGYQQYCNPSWGIDNATEVLEELGYTELLTEMNRVWKNLYKTDEDLWLHEFNKHGTCMSTVNPKCYDANAERYQYVGDFFTTAVELFKKLPTYEFLAAADIHPSTTETYTLEQFQNALSPHVGGASVFLQCDQHNSLLEVWYYFKLKGSVAEGTFTPVDAIAKYSKCQDKFYWVPKGTKRGGGGGGGGGGGGGGGGGSGTRGYLKLSGQDGCLIGNGRWYTSGTCATYTIINTVGGINIKSSKGYCNIVDGAFTCNQAVPAGDFTLEEKNVISYGGETTWSASNRPHGTQQTNISPGDDAGDISFELKFVPR"

     misc_feature    232..840
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /note="Ribonuclease T2 (RNase T2) is a widespread family
                     of secreted RNases found in every organism examined thus
                     far. This family includes RNase Rh, RNase MC1, RNase LE,
                     and self-incompatibility RNases (S-RNases). Plant T2
                     RNases are expressed during leaf...; Region: RNase_T2_euk;
                     cd01061"
                     /db_xref="CDD:238512"
     misc_feature    order(241..243,313..315,751..753)
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /note="B1 nucleotide binding pocket [chemical binding];
                     other site"
                     /db_xref="CDD:238512"
     misc_feature    order(253..255,268..270,466..468,745..747)
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /note="B2 nucleotide binding pocket [chemical binding];
                     other site"
                     /db_xref="CDD:238512"
     misc_feature    order(295..318,466..501)
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /note="CAS motifs [active]"
                     /db_xref="CDD:238512"
     misc_feature    order(304..306,313..315,319..321,475..480,487..492)
                     /gene="RNY1"
                     /locus_tag="AWJ20_1614"
                     /note="active site"
                     /db_xref="CDD:238512"
ORIGIN      

atgttgggaaggcccttagcgtttagtgtcggactggctagtctggccacttgtgtccagggcattgcaattgatattgagggctatggacgtgaccagctggtttttgctcccgttactggttttgagagtcctgttagaatcgcgtcagatcacgagtcatgtcccatagatgcccctctctcgtgttctacagagtctgttaaagacagttgttgttatgaggggacaaatggacttttcttgtcaacacaattctgggattattaccctcctactggccctgacgacgtgtttacacttcatggtctttggaatgacaagtgtaatggtggctaccagcagtactgtaacccatcatggggaatcgacaatgccaccgaggtcctagaagagttgggttacactgaattgttgaccgaaatgaatcgtgtgtggaagaatctatacaagacggacgaagacttatggctccatgagttcaacaagcatggaacatgtatgtctactgttaatcccaagtgttatgatgccaatgctgaaagatatcagtacgtgggtgattttttcaccaccgcagttgagctttttaagaagctccctacttacgagtttttggccgcagctgacattcatccttctacaactgagacatacactctagaacagttccagaatgcattatcacctcatgttggtggagcttcggtgttcctgcaatgtgatcaacacaattccttgttagaagtttggtattatttcaagcttaaaggatcagtagctgaaggaacatttactcctgtggatgctatcgccaagtacagcaaatgtcaggacaagttctattgggtaccaaagggtaccaagagagggggtggtggaggaggaggaggcggcggcggcggcggcggaggaggtggtagtggtactagaggatatctcaaactaagtggtcaagatggctgccttattggtaatggtagatggtatacctcgggaacatgtgccacctacaccataataaatactgtcggaggcatcaatatcaagtcatccaaaggatattgtaacatcgtagatggcgctttcacttgtaaccaggcagtgccggctggtgacttcactcttgaagagaaaaacgtgatttcttatggtggcgagacaacctggagcgcatccaacagacctcatggtactcaacagaccaacatctcaccaggcgatgatgcaggtgatatcagcttcgagctcaaatttgttcctcgctag

//