2024-05-20 10:06:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018575345 2755 bp mRNA linear VRT 30-SEP-2016 DEFINITION PREDICTED: Nanorana parkeri copper-transporting ATPase 1-like (LOC108803509), partial mRNA. ACCESSION XM_018575345 VERSION XM_018575345.1 DBLINK BioProject: PRJNA344660 KEYWORDS RefSeq; includes ab initio. SOURCE Nanorana parkeri ORGANISM Nanorana parkeri Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae; Dicroglossinae; Nanorana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017310083.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nanorana parkeri Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 12% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..2755 /organism="Nanorana parkeri" /mol_type="mRNA" /isolate="BGI_ZX_2015" /isolation_source="muscle sample" /db_xref="taxon:125878" /chromosome="Unknown" /sex="female" /country="China" /collection_date="Aug-2012" gene 1..>2755 /gene="LOC108803509" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins, and 72% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:108803509" CDS 1..>2755 /gene="LOC108803509" /codon_start=1 /product="copper-transporting ATPase 1-like" /protein_id="XP_018430847.1" /db_xref="GeneID:108803509" /translation="
MPGGVAAVWQHAGWSCRGLAACRVELQRSGSMPCGVAEVSLEDGNAAVIYDPAFWGPVTLQEAIEDMGFVSAPVSLHPQAVPTDSLVFHLSQDQAGERTCPDLLALKGVLDVTGEGSVLRVTFIPSLVSADTMIQRFPALSLDAPNPSQESAPDVVLLKMKVEGMTCHSCVSTIEGKIGKLQGVQRIKVSLDNQEAHILFQPHLITPDEIRSQIQKAGFSASLKSKPLAKLGKIDVGRLTTAQVNGNGDVSQPRPKPHTDLTRAVFQVEGMHCKSCVVNIEGGMASHAGVTGVEVSLEKRSAVITYHPNLTNSDALCRAMEALSPGTFRVTLDSVPRTTGTASQTPSKRTNPESPPQITVITIQGMTCNSCVQSIEGLISQKPGVRSIRVSLGDGTGTVEYDPAVTSPETLRDAIQDMGFDASLAEGMTSVTSLDPPRKPPHPSSQEMPVKSKQESSTSNKCFIRVSGMTCASCVANIERNLRKEDEGMTSVTSLDPPRKPPHPSSQEMPVKSKQESSTSNKCFIRVSGMTCASCVANIERNLRKEDGIHSVLVALMAGKAEVRYNPVLIQPAAIAELIQELGFEASVIENCDEGDGVLELVVRGMTCASCVHKIESCLMKTKGVLYGSVALATNKAHMKYDPEMIGPRDLMKIIDDLGFKTSLVKRDRSASHLDHRGEIQRWKQSFLISLIFCIPVMGLMIYMMFMDSDHMMPHHHNMTMDDITTYHPTMVLEYQVMPGLSIMNLLSFLLCIPVQFLGGWYFYIQAYKALKHRTANMDVLIVLATSIAFIYSLVILLVAVCEKAKVNPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALSRLISLQATEATIVTLGPDNSVLSEVPVDVELVQRGDIVKVTPGGKFPVDGRVIEGHSMVDESLITGKDTDIEGECR"
misc_feature <103..207 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature 475..666 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(493..501,508..510) /gene="LOC108803509" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 793..969 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(811..819,826..828) /gene="LOC108803509" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1078..1269 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1096..1104,1111..1113) /gene="LOC108803509" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1573..1761 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1588..1596,1603..1605) /gene="LOC108803509" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1798..1989 /gene="LOC108803509" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1816..1824,1831..1833) /gene="LOC108803509" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2053..>2724 /gene="LOC108803509" /note="Haloacid Dehalogenase-like Hydrolases; Region: HAD_like; cl21460" /db_xref="CDD:451251" ORIGIN
atgccgggtggagttgcagcggtctggcagcatgccgggtggagttgcagaggtctggcagcatgccgggtggagttgcagaggtctggcagcatgccgtgtggagttgcagaggtgtcgttggaagacgggaacgctgctgttatttatgatcccgccttctgggggccggtcactctccaggaagccattgaggacatgggatttgtgtcggctccggttagtttacatccacaagctgtacctacagacagtctcgtatttcacctctcccaggatcaggctggggagcggacctgcccggatctgctggcactgaagggggttctggatgtgacgggggaggggagcgtgctccgtgtgacttttataccgtcacttgtcagtgctgacaccatgattcagaggttcccggccctgagcctagacgccccgaaccccagccaagaatctgctccggacgttgtcctgctgaagatgaaggtggagggcatgacctgccattcctgcgtcagtaccatcgaaggcaaaatcgggaagctgcaaggcgtgcaacgcatcaaagtgtccctggataaccaggaagctcacatcctcttccagccgcacctcatcacgccggacgagatccggagccaaatccaaaaagccgggttttcggcatcgctgaagagcaagccgctcgccaagctggggaagatcgacgtcggccgactgaccactgcacaggtgaatggtaacggggacgtgtcccagccaagaccaaagccgcatactgacctaaccagagccgtcttccaagtagaaggcatgcactgcaaatcatgtgttgtgaacattgaaggcggcatggcgtctcatgccggggtgaccggggtggaagtgtcgttagagaaacgatccgcagtgatcacttatcatccaaatctcaccaattccgatgcactgtgcagagcgatggaagcgttgtctccggggaccttcagagtgactctggactctgtccccagaaccaccggaaccgcctcccaaaccccttccaagaggaccaatcccgagagtccaccccagatcaccgtcattaccattcaagggatgacctgcaattcatgtgtccagtccattgagggtctgatctcacagaagccgggtgtcaggtctattcgggtgtcactgggagatgggacggggactgtggagtatgacccggccgtcaccagtccggagaccctccgagacgctattcaggacatgggatttgatgcctctctagctgaaggaatgacatctgtcacctcattggatcccccccggaaacctccgcacccttcttcccaagaaatgcctgtgaagagcaagcaggagagcagcacaagcaacaagtgtttcattcgggtctccggcatgacgtgcgcttcctgtgtcgccaacatagagagaaatcttcgcaaggaggacgaaggaatgacatctgtcacctcattggatcccccccggaaacctccgcacccttcttcccaagaaatgcctgtgaagagcaagcaggagagcagcacaagcaacaagtgtttcattcgggtctccggcatgacgtgcgcttcctgtgtcgccaacatagagagaaatcttcgcaaggaggacggtatacattccgtcctggtggctctgatggcggggaaggccgaggtccggtacaacccggtgctcatacagccggcggccattgctgagctcattcaggagctgggattcgaggcctctgtgattgagaactgtgatgaaggagatggagtgctggaactggtggttcgggggatgacgtgcgcctcctgtgtacataagatcgagtcttgtctgatgaaaaccaaaggagttctgtacggttctgttgctctcgccaccaataaagctcacatgaaatatgacccggagatgattggaccgagagatctcatgaagattattgatgatttaggatttaaaacgtcgttggttaaaagagatcgatctgccagccacctggatcacaggggggagatacagaggtggaaacaatcgtttctgatcagtttaatattttgtatccctgtcatgggattaatgatctacatgatgttcatggacagtgatcacatgatgcctcaccaccacaacatgaccatggatgacataactacctaccatccgaccatggtgctggagtaccaggtcatgccaggactctccatcatgaacctcctgtcctttctgctgtgtatacctgtacagtttttaggaggctggtacttctacatacaagcatacaaggctctgaaacatagaacagccaacatggacgtgctgattgtcctggccacctccatcgccttcatctattccctggtgatccttctggtggccgtgtgtgagaaagccaaagtcaaccccgtcaccttcttcgacacgccgcccatgctcttcgtcttcatcgctctgggacggtggctggaacacctagccaagagcaaaacgtcggaagctttgtcccgtctgatctccctgcaggccacagaggccacaattgtcacgttgggccccgacaactctgtcctcagtgaggttccggtggacgtggagctggttcagcgcggagacattgtgaaggtgacacccggaggcaagttccctgtggacggacgcgtgattgaaggccactccatggtggatgaatctctcatcactggtaaagataccgacatagagggggagtgccggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]