2024-05-02 06:33:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018558523 3483 bp mRNA linear VRT 30-SEP-2016 DEFINITION PREDICTED: Nanorana parkeri NRDE-2, necessary for RNA interference, domain containing (NRDE2), mRNA. ACCESSION XM_018558523 VERSION XM_018558523.1 DBLINK BioProject: PRJNA344660 KEYWORDS RefSeq. SOURCE Nanorana parkeri ORGANISM Nanorana parkeri Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae; Dicroglossinae; Nanorana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017306612.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nanorana parkeri Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3483 /organism="Nanorana parkeri" /mol_type="mRNA" /isolate="BGI_ZX_2015" /isolation_source="muscle sample" /db_xref="taxon:125878" /chromosome="Unknown" /sex="female" /country="China" /collection_date="Aug-2012" gene 1..3483 /gene="NRDE2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 3 Proteins, and 91% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:108788692" CDS 29..3427 /gene="NRDE2" /codon_start=1 /product="protein NRDE2 homolog" /protein_id="XP_018414025.1" /db_xref="GeneID:108788692" /translation="
MALFPAFAASASTGPADDNKELNWLRNESFCTKDALSLHQRSLQAEPPSPACLSSPSPGRQSSDSEDGSEAGRKKKKKKKKKKKHKELKRRKRDNDDDASDSASEKRKGPESCRSEEHENEASQKSAPGVRSIWLEEAQPAAEETFRIDKKADPANWEYKSLYRGDIARYRRKGRSCLGIDPTRQLIVWEDAPGKKPSHKKPERYYSRSAVQALRIRAEHVACSKDNKDVASVGFIPVIDCNPDAPSASAARTSWVNPLGVYDDSTAMWLQGKGGLEDKTPPAAPRDTELLGRVEDYNRRTRENPGDVRTWMEFVSFQDELLAQPSMYSTSEGEVDCYRMSVKLLLEKKLSILDRAIESNPGSTELKLARLRLCAEFWEAPALLKEWQKLVFLHPNDPQLWQRYLLFSQSQFSTFSVSKVMAAYGKCLTTLAAVHDGSMVSHPAVPGTERAMCEIFLQQCHFLRQAGHCEKAVSLFQALIDFTFYKPDSVKDMTTKGQVEFFEPFWDSGEPRFGEKGAKGWSSWMRQQEKGGWVVVNNLGEEEDDDVEEELDIKDKSLPRHKTWLDMECLREARHWLPWRPDPDKKQTEEDCEDPERQVLFDDLGPSMFRITSPALKFQFIHSFLQFLGVPCGPRPSPACLYLALDELSLFDHRSASERLLTSFELPLAGVGTVGHLETMSRWRRQIGHCKDGECFIQNVFQSALSLFHGEQKMELCVSWLQYEISKVVQCIQAQRKKQLKSQGKRSKRLAKSLLKEPSNRNSLALWKEYALLEWLLGNTEEARKVFDAAISLAGGKGLKDQALCSLCLLYAELEGAIIDPSEGGGRSRAVHVLTSLAESSPYKPYSGPVQAIHILKARKTYARAVQDSLNLPPSASLVTLTGCYALFQYLTVGIDAAVAVFREVTGSLPPPASVPGESQDSHGTLQAVAGMHINLLMHHTKVSVYPRTPLRDALSDALRLYPDNITLWKSYIQTESRSHNISKARRFIDGVRRTSDALEPYLFAIRAEEDRKKLLESVQRADMGEVHTFMPETGLSNRIKALFEHCVSTERGSRCVLLWRMYLHFMVSLGRGDRGRGLFYKAIQSCPWAKVLYMDAVEYFPEQLQEVADLMTEKELRVRLPLEELDLLLED"
misc_feature 461..748 /gene="NRDE2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(461..487,494..499,509..514,518..520,524..568, 575..583,587..595,614..622,632..637,641..646,653..673, 695..703,719..748) /gene="NRDE2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 917..1915 /gene="NRDE2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:429988" ORIGIN
gccgccgtgtgttgttattagggactccatggctctatttccagcttttgcagcgtctgccagtaccggtccggccgatgataacaaagagcttaactggctgagaaacgagagcttttgtacgaaggacgcactgtctctgcatcagcggtcactgcaggctgagccgccctctcccgcctgtctgagcagtccctccccaggacgccagtcatccgacagtgaggatgggtcggaggctggtaggaaaaagaagaaaaaaaagaagaaaaagaagaaacacaaagagctgaaaaggaggaagagggacaacgatgacgacgcatctgattctgcctctgaaaaaagaaaagggccggagtcctgccggagtgaggagcacgagaatgaggcctcccagaagtcagcccccggagtccgctcgatctggctggaggaagctcagcctgcggcagaggagacgttcaggattgataagaaagctgacccagcaaactgggagtacaaatcgctgtaccgaggagacatagcgaggtacaggaggaaaggccgttcctgcttggggattgaccccacaagacagctcattgtatgggaggacgcccctgggaagaagccatctcataagaaacctgagcgatattatagcaggagtgcagtacaggcgctcaggatccgggcagagcatgtggcctgcagtaaggacaacaaggacgtggcatctgtcggcttcattcctgtgatagactgcaacccggatgccccctccgcctctgctgcccgcaccagctgggtgaatcctctgggtgtctatgacgattccactgcaatgtggctacaaggaaaaggaggcctggaggacaagaccccgccggctgctcctagagacaccgagctgctggggagggtggaggattataatcggaggacacgtgaaaaccccggagatgtgcggacgtggatggagtttgtctcatttcaggacgagttgttggcgcagcccagcatgtactccaccagcgagggagaggtggactgctatcgcatgtctgtcaagctgctcctggagaagaagctttccattctggaccgagccatcgagagcaacccgggcagcacggagctgaagctggcgcggttgcggctgtgcgcggagttctgggaggccccggccctgctgaaggagtggcagaagctggtcttcttgcatcccaacgacccgcagctgtggcagagatacctgctcttctcccagagtcagttcagcaccttctccgtctccaaagtcatggccgcctatggaaaatgtctcaccactctggccgcggtgcacgatggcagcatggtgtctcacccggctgtgccgggcaccgaacgcgccatgtgcgagatcttcctccagcagtgtcacttcctgcggcaggctggccactgtgagaaggcggtgtccttgttccaggcgctcattgacttcaccttctataagccggacagcgtgaaggacatgaccaccaaggggcaggtggaatttttcgagccgttttgggacagcggtgaacctcgattcggagaaaagggggcgaagggctggagctcatggatgcggcagcaggagaaaggaggctgggtggtcgtcaataacctaggggaggaggaagatgatgacgtggaggaagagcttgatataaaagacaagagtcttccccgtcataagacctggctggacatggagtgtttgcgggaggctagacattggttaccatggcgaccggacccggataagaagcagacggaggaagactgcgaggatcctgagagacaggtcctctttgatgacctcgggccatcgatgttcaggatcaccagcccggcattgaagttccagttcatacattccttcctgcagttcctgggtgtcccctgtggccccaggccttctccggcctgtctgtacctcgccctggatgagctctccctcttcgaccacaggtcagccagtgagaggctgctgacttcatttgagctgcccctggccggagtcggtacagtcggtcaccttgaaacgatgagcagatggaggcggcagataggacattgtaaggacggtgaatgcttcatacagaacgtcttccagtccgcactgtccttgttccacggagagcagaagatggaactgtgtgtcagctggctgcagtatgaaatctccaaggtcgtccagtgtattcaagcacagaggaaaaagcagctaaaatcccaggggaagcggagtaagagacttgccaaaagcctgctgaaagagccatcgaaccgcaacagcctggcgctgtggaaggagtatgccctcctggagtggctgctggggaacacagaggaggccaggaaggtgtttgatgctgcaatcagtctggcaggtggcaaagggttaaaggaccaagcactctgcagcctctgtttattgtatgccgaactagaaggggcgattatagacccttcggaggggggcggccggtctcgagcagtccatgtactcaccagcctggcagaaagttccccctacaaaccatacagtggacccgtccaggctattcatattttaaaagcgcgaaaaacctacgcgcgcgctgtgcaggacagcttaaatttgccgccatctgcgtcgctggttaccttaactgggtgctatgcactttttcagtatctcaccgtgggcattgacgctgctgttgcagtgttcagagaggtcactggctcactgccaccccctgcatctgtgcctggagaatcgcaggactcgcatggcacactgcaggccgtcgcggggatgcacatcaacttgctcatgcatcatactaaggttagcgtgtacccacggacgcctctcagggacgcattgtctgacgctttacgtctgtaccccgacaacatcaccctgtggaaatcctacatccagactgagagcaggtctcacaatatcagcaaagccaggaggttcatcgacggggtcaggaggacgtcggatgccctggagccatatctgtttgccattcgggcagaggaggataggaagaagcttctggaatccgttcagagggcggatatgggagaggtgcacacttttatgccagagacgggcctgtccaaccgaatcaaggccttgtttgagcactgtgtgagcacggagcgtggatcccgctgtgtactactctggaggatgtacctgcacttcatggtttctctgggacgtggcgacaggggtcgaggtctcttctacaaggcgatacagagctgcccgtgggctaaggtgctatacatggacgccgtggagtacttccccgagcagttgcaggaagttgctgatctgatgacggagaaagagctgagagttcgccttcctctggaggagctggacttactattagaagattaatgctgcagcacaaatctctttttacatgatctctgtatagagcaaaaagtcctatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]