2024-04-26 15:04:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018556445 4417 bp mRNA linear VRT 30-SEP-2016 DEFINITION PREDICTED: Nanorana parkeri ATPase copper transporting beta (ATP7B), mRNA. ACCESSION XM_018556445 VERSION XM_018556445.1 DBLINK BioProject: PRJNA344660 KEYWORDS RefSeq; includes ab initio. SOURCE Nanorana parkeri ORGANISM Nanorana parkeri Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae; Dicroglossinae; Nanorana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017306506.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nanorana parkeri Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 2% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..4417 /organism="Nanorana parkeri" /mol_type="mRNA" /isolate="BGI_ZX_2015" /isolation_source="muscle sample" /db_xref="taxon:125878" /chromosome="Unknown" /sex="female" /country="China" /collection_date="Aug-2012" gene 1..4417 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 16 Proteins, and 89% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:108787014" CDS 1..4389 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2" /protein_id="XP_018411947.1" /db_xref="GeneID:108787014" /translation="
MSRRNFLEDEEEEVRLLSNYEVRYREKSMTKPSPHQSKNKNTAVWKKAERNNSAFDNQGYEGSQDDLAFSSSVVLAIVGMTCQSCVQSIEGKISKLPSIIRIKVCLDQNNATVHYIRSEITAQKICEEIEDMGFEASIQECKEMTAPQKGMSYKEEVIKIRIEGMTCQSCVNTIEGKIGKLQGVQKIKVSLTGQEAVIVYDPLYIQPEDLKKHIDDMGFVASLKSKPDPLKLGTIDIERLQTVPIHRNISDSDGAVIDGQKEIATIGIEGMHCKSCVYNIEGSISDLPGVQSIKVSLENKNAILCFFKSVTDLVTVKEEIEALPPGNFKVILSLAEHSRPSTKLKSKYHSSYKQSHLPATKMALIRIVGMTCGSCVSSIENMISQRKGVQSISVLLDEALGTIYYIPSETNAEELRAAIEDMGFDATLVSDSAVPITSNQTEPDTRQNSLAMLKELTTHKDYIVDVMPKKLHLDIDIPLSDNRAPQKCVLQVTGMTCASCVSNIERNLKKKDGIVSVLVALMAGKAEVRYIGDRIEPTEIAQLIENLGFGAVVLEDCTAADGCIELVITGMTCASCVHNIESRLMRTPGILQAAVALGTCKAQIKFDPEVVGPRDIINVIEGIGFRASLPQRDPTAHNLDHKQEIRLWRNSFLSSLFFGIPVICIMIYMLFAQKRKEPSKLEANIIPGLSIMNLIFFILCTLVQCLGGWYFYVQAYKSLKHKATNMDVLIVLATTIAYIYSVVILIVAMVEKSEQSPETFFDTPPMLFMFIALGRWLEHIAKGKTSEALAKLISLQATEATVVTLEQNFSVIREEQVDVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEPMPVRKRPGSIVIAGSINAHGSVLVEATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKISGYFVPFIIITSIVTLIAWITVGFVNFDIIIKYFPGYSKTMSKAEVIIRVAFQTSITVLSIACPCALGLATPTAVMVGTGVAAQNGILIKGGEPLEMAHKINIVMFDKTGTITHGVPKVMRVLLLCDVSRMPLKRMLAVVGTAEASSEHPLGVAVAKYCKEELGTASLGYCSDFQAVPGCGISCKVNNVESVLVQSEEGQNEYNVYKSGSQDNNSLIITPELQGASAPIPHAVLIGNREWMKRNGLHISHDVDDAMTSHEMKGQTAVLVAIDGALCGMIAIADTVKQEAALAVHTLMAMGVDVVLITGDNRKTAKAIATQVGIRKVFAEVLPSHKVAKVQALQNEGKRVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADIVLIRNDLLDVVASIHLSKRTVRRIRMNFMFALIYNLLGIPIAAGVFLPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYNKPDSDRYEALAQGLMKPLTPSQISVHVGMDDRRRDISSTWDQISYISQGSANKISRENSLTGERQDKWSLLISETDEDHYI"
misc_feature 220..411 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(238..246,253..255) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 475..666 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(493..501,508..510) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 793..969 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(811..819,826..828) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1093..1281 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1108..1116,1123..1125) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1465..1653 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1483..1491,1498..1500) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1693..1884 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1711..1719,1726..1728) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1948..4074 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2938..2940,2944..2946,4003..4005) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3070..3078,3280..3282,3454..3462,3550..3552, 3670..3678,3736..3738,3745..3747,3754..3756,3811..3813, 3820..3822) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
atgtccaggaggaattttctggaggatgaggaggaggaagtgcggttactcagtaattatgaagtgcggtacagagaaaaatccatgacaaagccgtcacctcaccagtccaaaaacaagaacactgcggtttggaagaaagcagaaagaaataattctgctttcgacaatcagggttatgaaggcagccaagatgacctggccttctcatcctccgtggtgctagcaattgtaggcatgacgtgccagtcatgtgttcagtccatcgagggaaagatctccaagctgccgagcataattagaattaaggtttgcttggatcaaaacaatgccactgtacactatatccgctcagaaataaccgctcagaagatctgtgaagagatagaagacatgggctttgaagctagcatacaagagtgcaaggagatgacagcaccacagaaaggcatgagttacaaagaagaggtgatcaagatcaggatagagggcatgacctgtcagtcttgtgtcaacacaattgaaggcaaaattgggaaacttcaaggtgtccaaaaaataaaggtgtcccttacaggccaagaagcagtcattgtgtatgatccactgtacattcagccggaagaccttaagaaacatatagatgacatgggatttgtggcttctcttaagagtaaacctgaccctttaaagcttggaacaattgacatagaacgtttgcagactgttcctatacatcgtaacatttcagactctgatggcgctgtcattgatggtcaaaaagagatagcgactattggtatagaagggatgcactgcaaatcttgcgtctacaatatagaagggtccatatcagacctccctggtgttcagagtatcaaagtctcacttgaaaacaaaaatgctattttatgtttctttaaaagtgttactgacttggttactgtaaaagaggaaattgaagcgcttcctcccggcaatttcaaggttatactttcattggcagaacattcaaggccctcaacaaagttgaaatccaagtatcattcttcctataaacaaagtcatctgccagctaccaaaatggccttaatccgcattgtaggaatgacctgtggatcctgtgtgtcctctattgaaaacatgatctctcagagaaaaggagtacagtccatatcggttttattagatgaagcactcggaacaatttactatatcccaagtgaaacaaatgcagaggagcttagggcagccatagaagacatggggtttgatgctacacttgtatctgattctgcagtgcctataaccagcaaccagacagaacctgacacaaggcaaaattccttagcaatgttgaaggaactgactacccataaagattatattgtggatgttatgcctaagaagctgcacctggatattgatattcctttgagcgataacagagcgccgcagaaatgtgttttacaggtcaccgggatgacatgtgcttcctgtgtgtctaacattgagaggaatctgaagaagaaagatggtattgtttctgtgctggtggcactgatggctggtaaagcagaagtcagatacataggagaccggattgaaccaacagagattgcccaacttattgaaaacctggggtttggagcagtagtattggaggactgcactgctgcagatggctgtattgagctagtgattacaggaatgacctgcgcatcatgtgttcataacattgaatcccgactgatgagaacgccagggattctacaggccgccgtagctctgggtacctgcaaagcacaaatcaaatttgatccagaagttgttgggccgagggacatcattaatgtgattgagggaattggatttcgagcatctttaccccaaagggatcccacagctcataacctggatcataaacaggaaataaggctgtggaggaactcctttttgtccagccttttttttgggatccctgtcatctgcatcatgatttatatgttatttgcccaaaaaagaaaagagccatcaaaactggaagcgaacatcatccctgggctatccattatgaacctcatcttctttattctttgtacactggttcagtgcctcggaggatggtacttctatgtacaggcttataagtctctgaagcacaaggcaaccaacatggatgttctgattgtcctggccaccaccattgcttatatttattccgtggttatcctgattgtggccatggtagagaagtctgagcagagcccagagactttcttcgacacaccgcccatgctcttcatgtttattgctctggggagatggctggagcacatagcaaagggtaaaacgtcggaggctctagctaagctcatatctctgcaagctacggaggcgactgttgtgacccttgaacaaaatttctcagtcataagggaggagcaggtggatgtagaattggtacagagaggagatatcgtaaaggttgtgcctggaggcaagtttccagttgatggaaaagtaattgaagggacgtctatggcagatgaatctcttatcacaggagagcctatgcctgtcaggaaaaggccaggcagcattgttattgctgggtccattaatgctcatggctctgtgctggttgaggcaactcatgtgggctctgacaccaccttggcacaaattgtgaagttagtggaagaagctcagatgtccaaggcacctatccagcagctggctgataaaatcagtggatattttgttcctttcataattatcacctccattgtcacactgattgcctggatcacagttgggtttgtgaattttgatatcataatcaaatattttccgggttacagcaaaacgatgtctaaggctgaagtgatcatacgggtggcgtttcagacttccatcactgtgctgtctattgcctgtccttgtgctctgggcctggctacacctacggctgtcatggtgggtactggagttgctgcacaaaatggcatcctcatcaaaggaggagaaccgctagaaatggcacacaagataaacatagtgatgtttgataaaacaggcacaataacgcacggggtccccaaggttatgagagtgctgttgctttgtgatgtgtcacggatgcccctgaaaaggatgctcgcagttgtggggacagccgaggccagcagtgaacacccccttggagtggctgttgctaaatactgcaaagaggagcttggcacagcatctctgggttattgttcagatttccaggctgttcctggctgtgggatcagctgcaaagtgaacaatgtggagagtgtcctggtgcagagcgaagagggacagaatgagtacaacgtttacaagagtggatcacaggataataacagcttgatcattacacctgaattacaaggtgccagtgccccaatccctcacgctgtattaattgggaaccgggaatggatgaaacgcaatggacttcatatttcccatgatgtagatgatgccatgactagccatgaaatgaaaggacagacagcagtgctggttgctatagatggtgcattgtgcggaatgattgcaattgcagacactgtgaagcaggaagccgcccttgctgtgcacactttaatggctatgggagtggatgttgtacttataacaggtgataaccggaagaccgccaaagctattgctacccaggttgggatccgaaaggtgtttgcagaagttcttccctctcacaaggtagccaaagtccaggcactgcagaatgaggggaagagagtcgccatggtgggtgatggtgtcaatgactccccagcattggccagagctgatatcggtatcgccatcgggacaggaactgatgtggccattgaagctgcagatattgttctcatcaggaatgacttgcttgatgtagttgccagcattcatctctcaaagaggacagtgagaaggataagaatgaatttcatgtttgctctgatatacaatcttctcggcattcctattgcggcaggtgtcttcttgccagtggggttggtgctacagccatggatgggatcagcagcaatggcagcttcttctgtctctgtggttttatcatcattacagttaaagtgctacaataagccagactccgacagatatgaagccctggcccaaggcctcatgaaaccacttacaccatcacagataagtgttcatgttgggatggatgaccggagaagagatatttccagtacttgggaccagatcagttacatcagccaaggctctgcaaataaaatctcacgagagaactctttaacgggagagagacaagataaatggtctctcctgatcagtgaaaccgatgaagaccactacatataaaacaatggcagtaaaaattcattggcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]