GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 15:04:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018556445            4417 bp    mRNA    linear   VRT 30-SEP-2016
DEFINITION  PREDICTED: Nanorana parkeri ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_018556445
VERSION     XM_018556445.1
DBLINK      BioProject: PRJNA344660
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Nanorana parkeri
  ORGANISM  Nanorana parkeri
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Neobatrachia; Ranoidea; Dicroglossidae;
            Dicroglossinae; Nanorana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017306506.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nanorana parkeri Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 2% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..4417
                     /organism="Nanorana parkeri"
                     /mol_type="mRNA"
                     /isolate="BGI_ZX_2015"
                     /isolation_source="muscle sample"
                     /db_xref="taxon:125878"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="China"
                     /collection_date="Aug-2012"
     gene            1..4417
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 16 Proteins, and 89% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:108787014"
     CDS             1..4389
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_018411947.1"
                     /db_xref="GeneID:108787014"
                     /translation="
MSRRNFLEDEEEEVRLLSNYEVRYREKSMTKPSPHQSKNKNTAVWKKAERNNSAFDNQGYEGSQDDLAFSSSVVLAIVGMTCQSCVQSIEGKISKLPSIIRIKVCLDQNNATVHYIRSEITAQKICEEIEDMGFEASIQECKEMTAPQKGMSYKEEVIKIRIEGMTCQSCVNTIEGKIGKLQGVQKIKVSLTGQEAVIVYDPLYIQPEDLKKHIDDMGFVASLKSKPDPLKLGTIDIERLQTVPIHRNISDSDGAVIDGQKEIATIGIEGMHCKSCVYNIEGSISDLPGVQSIKVSLENKNAILCFFKSVTDLVTVKEEIEALPPGNFKVILSLAEHSRPSTKLKSKYHSSYKQSHLPATKMALIRIVGMTCGSCVSSIENMISQRKGVQSISVLLDEALGTIYYIPSETNAEELRAAIEDMGFDATLVSDSAVPITSNQTEPDTRQNSLAMLKELTTHKDYIVDVMPKKLHLDIDIPLSDNRAPQKCVLQVTGMTCASCVSNIERNLKKKDGIVSVLVALMAGKAEVRYIGDRIEPTEIAQLIENLGFGAVVLEDCTAADGCIELVITGMTCASCVHNIESRLMRTPGILQAAVALGTCKAQIKFDPEVVGPRDIINVIEGIGFRASLPQRDPTAHNLDHKQEIRLWRNSFLSSLFFGIPVICIMIYMLFAQKRKEPSKLEANIIPGLSIMNLIFFILCTLVQCLGGWYFYVQAYKSLKHKATNMDVLIVLATTIAYIYSVVILIVAMVEKSEQSPETFFDTPPMLFMFIALGRWLEHIAKGKTSEALAKLISLQATEATVVTLEQNFSVIREEQVDVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEPMPVRKRPGSIVIAGSINAHGSVLVEATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKISGYFVPFIIITSIVTLIAWITVGFVNFDIIIKYFPGYSKTMSKAEVIIRVAFQTSITVLSIACPCALGLATPTAVMVGTGVAAQNGILIKGGEPLEMAHKINIVMFDKTGTITHGVPKVMRVLLLCDVSRMPLKRMLAVVGTAEASSEHPLGVAVAKYCKEELGTASLGYCSDFQAVPGCGISCKVNNVESVLVQSEEGQNEYNVYKSGSQDNNSLIITPELQGASAPIPHAVLIGNREWMKRNGLHISHDVDDAMTSHEMKGQTAVLVAIDGALCGMIAIADTVKQEAALAVHTLMAMGVDVVLITGDNRKTAKAIATQVGIRKVFAEVLPSHKVAKVQALQNEGKRVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADIVLIRNDLLDVVASIHLSKRTVRRIRMNFMFALIYNLLGIPIAAGVFLPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYNKPDSDRYEALAQGLMKPLTPSQISVHVGMDDRRRDISSTWDQISYISQGSANKISRENSLTGERQDKWSLLISETDEDHYI"
     misc_feature    220..411
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(238..246,253..255)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    475..666
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(493..501,508..510)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    793..969
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(811..819,826..828)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1093..1281
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1108..1116,1123..1125)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1465..1653
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1483..1491,1498..1500)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1693..1884
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1711..1719,1726..1728)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1948..4074
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2938..2940,2944..2946,4003..4005)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3070..3078,3280..3282,3454..3462,3550..3552,
                     3670..3678,3736..3738,3745..3747,3754..3756,3811..3813,
                     3820..3822)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
atgtccaggaggaattttctggaggatgaggaggaggaagtgcggttactcagtaattatgaagtgcggtacagagaaaaatccatgacaaagccgtcacctcaccagtccaaaaacaagaacactgcggtttggaagaaagcagaaagaaataattctgctttcgacaatcagggttatgaaggcagccaagatgacctggccttctcatcctccgtggtgctagcaattgtaggcatgacgtgccagtcatgtgttcagtccatcgagggaaagatctccaagctgccgagcataattagaattaaggtttgcttggatcaaaacaatgccactgtacactatatccgctcagaaataaccgctcagaagatctgtgaagagatagaagacatgggctttgaagctagcatacaagagtgcaaggagatgacagcaccacagaaaggcatgagttacaaagaagaggtgatcaagatcaggatagagggcatgacctgtcagtcttgtgtcaacacaattgaaggcaaaattgggaaacttcaaggtgtccaaaaaataaaggtgtcccttacaggccaagaagcagtcattgtgtatgatccactgtacattcagccggaagaccttaagaaacatatagatgacatgggatttgtggcttctcttaagagtaaacctgaccctttaaagcttggaacaattgacatagaacgtttgcagactgttcctatacatcgtaacatttcagactctgatggcgctgtcattgatggtcaaaaagagatagcgactattggtatagaagggatgcactgcaaatcttgcgtctacaatatagaagggtccatatcagacctccctggtgttcagagtatcaaagtctcacttgaaaacaaaaatgctattttatgtttctttaaaagtgttactgacttggttactgtaaaagaggaaattgaagcgcttcctcccggcaatttcaaggttatactttcattggcagaacattcaaggccctcaacaaagttgaaatccaagtatcattcttcctataaacaaagtcatctgccagctaccaaaatggccttaatccgcattgtaggaatgacctgtggatcctgtgtgtcctctattgaaaacatgatctctcagagaaaaggagtacagtccatatcggttttattagatgaagcactcggaacaatttactatatcccaagtgaaacaaatgcagaggagcttagggcagccatagaagacatggggtttgatgctacacttgtatctgattctgcagtgcctataaccagcaaccagacagaacctgacacaaggcaaaattccttagcaatgttgaaggaactgactacccataaagattatattgtggatgttatgcctaagaagctgcacctggatattgatattcctttgagcgataacagagcgccgcagaaatgtgttttacaggtcaccgggatgacatgtgcttcctgtgtgtctaacattgagaggaatctgaagaagaaagatggtattgtttctgtgctggtggcactgatggctggtaaagcagaagtcagatacataggagaccggattgaaccaacagagattgcccaacttattgaaaacctggggtttggagcagtagtattggaggactgcactgctgcagatggctgtattgagctagtgattacaggaatgacctgcgcatcatgtgttcataacattgaatcccgactgatgagaacgccagggattctacaggccgccgtagctctgggtacctgcaaagcacaaatcaaatttgatccagaagttgttgggccgagggacatcattaatgtgattgagggaattggatttcgagcatctttaccccaaagggatcccacagctcataacctggatcataaacaggaaataaggctgtggaggaactcctttttgtccagccttttttttgggatccctgtcatctgcatcatgatttatatgttatttgcccaaaaaagaaaagagccatcaaaactggaagcgaacatcatccctgggctatccattatgaacctcatcttctttattctttgtacactggttcagtgcctcggaggatggtacttctatgtacaggcttataagtctctgaagcacaaggcaaccaacatggatgttctgattgtcctggccaccaccattgcttatatttattccgtggttatcctgattgtggccatggtagagaagtctgagcagagcccagagactttcttcgacacaccgcccatgctcttcatgtttattgctctggggagatggctggagcacatagcaaagggtaaaacgtcggaggctctagctaagctcatatctctgcaagctacggaggcgactgttgtgacccttgaacaaaatttctcagtcataagggaggagcaggtggatgtagaattggtacagagaggagatatcgtaaaggttgtgcctggaggcaagtttccagttgatggaaaagtaattgaagggacgtctatggcagatgaatctcttatcacaggagagcctatgcctgtcaggaaaaggccaggcagcattgttattgctgggtccattaatgctcatggctctgtgctggttgaggcaactcatgtgggctctgacaccaccttggcacaaattgtgaagttagtggaagaagctcagatgtccaaggcacctatccagcagctggctgataaaatcagtggatattttgttcctttcataattatcacctccattgtcacactgattgcctggatcacagttgggtttgtgaattttgatatcataatcaaatattttccgggttacagcaaaacgatgtctaaggctgaagtgatcatacgggtggcgtttcagacttccatcactgtgctgtctattgcctgtccttgtgctctgggcctggctacacctacggctgtcatggtgggtactggagttgctgcacaaaatggcatcctcatcaaaggaggagaaccgctagaaatggcacacaagataaacatagtgatgtttgataaaacaggcacaataacgcacggggtccccaaggttatgagagtgctgttgctttgtgatgtgtcacggatgcccctgaaaaggatgctcgcagttgtggggacagccgaggccagcagtgaacacccccttggagtggctgttgctaaatactgcaaagaggagcttggcacagcatctctgggttattgttcagatttccaggctgttcctggctgtgggatcagctgcaaagtgaacaatgtggagagtgtcctggtgcagagcgaagagggacagaatgagtacaacgtttacaagagtggatcacaggataataacagcttgatcattacacctgaattacaaggtgccagtgccccaatccctcacgctgtattaattgggaaccgggaatggatgaaacgcaatggacttcatatttcccatgatgtagatgatgccatgactagccatgaaatgaaaggacagacagcagtgctggttgctatagatggtgcattgtgcggaatgattgcaattgcagacactgtgaagcaggaagccgcccttgctgtgcacactttaatggctatgggagtggatgttgtacttataacaggtgataaccggaagaccgccaaagctattgctacccaggttgggatccgaaaggtgtttgcagaagttcttccctctcacaaggtagccaaagtccaggcactgcagaatgaggggaagagagtcgccatggtgggtgatggtgtcaatgactccccagcattggccagagctgatatcggtatcgccatcgggacaggaactgatgtggccattgaagctgcagatattgttctcatcaggaatgacttgcttgatgtagttgccagcattcatctctcaaagaggacagtgagaaggataagaatgaatttcatgtttgctctgatatacaatcttctcggcattcctattgcggcaggtgtcttcttgccagtggggttggtgctacagccatggatgggatcagcagcaatggcagcttcttctgtctctgtggttttatcatcattacagttaaagtgctacaataagccagactccgacagatatgaagccctggcccaaggcctcatgaaaccacttacaccatcacagataagtgttcatgttgggatggatgaccggagaagagatatttccagtacttgggaccagatcagttacatcagccaaggctctgcaaataaaatctcacgagagaactctttaacgggagagagacaagataaatggtctctcctgatcagtgaaaccgatgaagaccactacatataaaacaatggcagtaaaaattcattggcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]