GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 15:12:23, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_018228841            3615 bp    mRNA    linear   VRT 20-SEP-2016
DEFINITION  PREDICTED: Xenopus laevis NRDE-2, necessary for RNA interference,
            domain containing L homeolog (nrde2.L), transcript variant X1,
            mRNA.
ACCESSION   XM_018228841
VERSION     XM_018228841.1
DBLINK      BioProject: PRJNA338693
KEYWORDS    RefSeq.
SOURCE      Xenopus laevis (African clawed frog)
  ORGANISM  Xenopus laevis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Xenopus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030738.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Xenopus laevis Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3615
                     /organism="Xenopus laevis"
                     /mol_type="mRNA"
                     /strain="J"
                     /db_xref="taxon:8355"
                     /chromosome="8L"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..3615
                     /gene="nrde2.L"
                     /gene_synonym="c14orf102; nrde2"
                     /note="NRDE-2, necessary for RNA interference, domain
                     containing L homeolog; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 5 ESTs, 4 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 54 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:432030"
                     /db_xref="Xenbase:XB-GENE-960405"
     CDS             89..3490
                     /gene="nrde2.L"
                     /gene_synonym="c14orf102; nrde2"
                     /codon_start=1
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing L homeolog isoform X1"
                     /protein_id="XP_018084330.1"
                     /db_xref="GeneID:432030"
                     /db_xref="Xenbase:XB-GENE-960405"
                     /translation="
MALFPAFADSSSSEKHPTRQELDWLSNKSFCTEDALSLHQRTLQSALSPQPASHSPRSPLQPGLSEESGTDSRSTKKKKKKKKKKQKKKHKKKRDYEEDEEGNTSDSDSSPEIRESTATEREARQDTCVVLPGRGIWLDEAQSVTEETFRIDKKSDPANWEYKSLYRGDIARYKRKGNSCLGINPKKQQIIWQDTLSKKKQPQRKIERYFTKSTVQLLRAKADFVSCKESASRNAGDFIPVLDPDMDGVVSSSGPISWVNPLGVYDSSTALWLEGKGGPEYETIQPVPRDNNILAKVEDYNKRLRECPSDIQLWMEFVSFQDELVKQPSMYSTSKGELESHRTSVKLLLEKKLAILERSIESNLGSTELKLAKLKLCEEFWEAPALLKEWQKLIFLYPNDSQLWQKYLLFCQGQFSTFSVSKMNGVYGKCLSTLAAVQDGSMLSHNALPDTDRQMYDIFLQQCQFLRQAGHTEKAISLFQALTDFTFYKPDTVKHMTTKEQVDFFEPFWDSGEPRFGEKGAKGWSSWMRQQERGGWVTINNLVGDDEDEADEEFNIKDKTCPRYKIWLDIEYSREARHWLPWHPDPTKKQTEDDCEDPERQVLFDDIGPSMFKIDSPQLQFQLLQSFLHFVGVPCGAHLSLYCFYLFLDETSIFDHVSPYERLLTSFEIPLSGIGTVGHLDTISRSRQQIGHFKEGETFIQNIFQSALSLLQGEEKRKLSVWWLRYEISKVVWWLQAKNKKKLKSQGKRSKRLAKGLLKESSNRNSLALWKEYALLEWLLGNIDDARKVFDTAISLAGSKGLKDQELCSLCLLYSELEGKILDNPEQNAGSRAVHILTSLTESSPYIPYSSPEHAVSILKARKVYEHALQDCLMQEPHWGRVSLSGCFALFQYLTVSVDAAVAVLRQAADSQLIPETPYNIERNSDCPLQAITLMHTNLLRHHYKASVYPLRPLRETLMSALKLYPTNVSLWKSYIMTESKLHNASKVRRFIDSIRRVTSALEPCLFAIRAEEDRRKLVDSVQRAELGEVHSIFPETGLSNRIKALFEHALQSEYGSRCPLLWRQYLYFMVSIKERSKGLFYKAIQSCPWAKALYLDAVEYFPEQLQETIDLMTEKELRVRVPLEELDLLLED"
ORIGIN      
tgagcccggcgcacagccaagatgtcgaaaggtttgtcgggaaaaacgtcattcgagtgcgacgcatttgttgacaggttgagaagcaatggcactgtttccagcctttgcagactctagttctagtgagaaacatccaacacgccaagagttggactggctgagcaacaagagcttctgcacagaagatgccctatcactacatcagcgcactttacagtctgcactctctcctcagcctgcatcccactcacccaggagtccgttacagccagggttgtcagaggaaagtggaacagattctcggtcaacaaagaagaagaaaaagaagaaaaaaaagaaacagaaaaaaaagcacaagaaaaagagggattatgaggaggatgaagaagggaatacaagtgactctgactcaagtcctgagataagggaatctacagccactgaaagggaagcaaggcaggacacttgtgttgtgctccctggccgtggtatatggctagatgaagcacagtctgtgacagaggagacatttcgaattgataagaaatctgaccctgccaactgggaatataagtcactgtaccgaggagacatagcacgctacaaacgtaaaggaaattcctgtcttggcattaacccaaagaagcagcaaattatttggcaggatacattatctaagaagaaacagcctcagaggaaaattgagcgctattttaccaagagcacagtgcagcttctcagagccaaagcagattttgtgtcttgtaaagaaagtgcaagtcggaatgcaggggactttattcccgtcttggatcctgatatggatggtgttgtttcctccagtggccccattagttgggtgaatcctttgggagtttatgattcttctacagctctgtggttggaaggaaaagggggcccagaatatgaaaccatacagccagtaccccgggacaacaatattttagcaaaggtggaggattataataagcggctcagagaatgtccgagcgatatccagctatggatggagtttgtctctttccaggatgagctggtgaagcagcctagcatgtattctactagcaaaggagagcttgaaagccatcggacatctgtgaagttgctactggaaaagaaactagccatactagagagatccattgagagtaatctgggcagcactgaattgaagcttgcaaagctaaaactgtgtgaggaattctgggaggcacctgctcttctgaaggaatggcagaaactgatcttcttgtacccaaatgactcgcagctgtggcagaaatacctactcttctgccaggggcagtttagcactttctctgtgtccaagatgaatggtgtttatggcaaatgcctaagcaccctggcagcagttcaggatggcagtatgctttcccacaatgctctgccagacacagatcgccaaatgtatgatattttcctgcaacagtgccagtttttacgccaggctggacacaccgagaaagcaatatctttgttccaggccctgacagacttcacattttataaaccggacactgttaagcacatgacaaccaaagagcaggttgacttttttgagcctttttgggacagtggggaacctcgttttggtgagaaaggagcaaagggatggagctcctggatgcgtcaacaggagagagggggctgggtcaccattaacaacttggtgggggatgatgaagatgaagcagatgaagagttcaacataaaagacaaaacctgccccagatacaagatttggctggacattgaatactcacgggaagccagacactggttgccatggcatccagacccaacgaaaaagcagacagaggacgactgtgaggacccagaaaggcaggtgctctttgatgacattggtccatcaatgttcaagattgacagccctcaactgcagttccaactgttacagtctttcctgcactttgtgggggtcccctgtggggcacacctttccttatactgcttttatctttttcttgacgagacctccatctttgatcatgtttctccatatgaaaggctgcttacttcatttgaaatccctctgtctggaatcggaacagttggtcatttagacacaataagcagaagcagacagcaaataggacactttaaagaaggtgaaaccttcatacaaaacatcttccagtcagctctgtcacttttacaaggagaagagaaaaggaagctctctgtctggtggcttcggtatgaaatttcgaaggttgtttggtggctgcaagcaaaaaacaagaaaaagttgaaatctcagggcaagaggagtaagcgattggcaaagggtctactaaaggaatcatctaacagaaacagtctggcactctggaaagaatatgccctactggaatggcttctgggcaatattgatgatgcccgaaaggtgtttgatacagccataagcttagcaggaagcaaagggttaaaggaccaggaattatgcagtctgtgcctgctgtattcagaactggaagggaagatactggacaatccagagcaaaatgcagggtcccgtgctgttcatatactaaccagccttacagaaagctccccttacatcccctatagtagccctgagcatgctgttagtattcttaaagcacgcaaggtatacgaacacgctttgcaggactgcctgatgcaagagccacactgggggcgtgtgagcttatctggctgctttgcactttttcagtatcttacggtgagtgttgatgctgctgttgcagtattaagacaggctgctgactcacagttgattcctgaaacaccgtacaatattgaacggaactccgactgccccttgcaagcaatcacattgatgcacacaaatctgctcaggcaccattataaggccagtgtctatcctctgaggccacttagagaaacactgatgtctgccttaaagctgtatcccacaaatgtttctttgtggaaatcctacatcatgacagaaagtaaattacacaatgccagcaaagtgagacggtttatagacagcatcaggagagtgacatcagctctggaaccatgtctgtttgccattagggcagaggaagacagaagaaaactggtagactctgtgcaacgggcagaactaggggaggttcactccattttccctgaaactggtttgtcaaatcgaatcaaggccctgtttgaacatgctcttcaaagtgaatatggttccagatgccctctactctggagacagtacttgtactttatggtatctatcaaggagagaagcaaaggcctgttctacaaagcaatacagagctgcccatgggcaaaggcactgtatctggatgctgtagaatatttcccagagcagctacaagagaccattgatctaatgactgaaaaggagttgagagtacgagttcccctagaggaattggatcttctgctggaagattaaacaatggaacgattgaaatgtttttgtttgggttacatctataatgcaacaaacgtgtacaatacattttatacaatatgtatatttttaagaaaaaaaacaataaaatgtgtccacaccctcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]