GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 07:45:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018225529            1350 bp    mRNA    linear   VRT 14-MAY-2021
DEFINITION  PREDICTED: Xenopus laevis pituitary homeobox 3-like [provisional] L
            homeolog (homeobox100496651-provisional.L), mRNA.
ACCESSION   XM_018225529
VERSION     XM_018225529.2
DBLINK      BioProject: PRJNA338693
KEYWORDS    RefSeq.
SOURCE      Xenopus laevis (African clawed frog)
  ORGANISM  Xenopus laevis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Xenopus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_054383.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 14, 2021 this sequence version replaced XM_018225529.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus laevis Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1350
                     /organism="Xenopus laevis"
                     /mol_type="mRNA"
                     /strain="J_2021"
                     /db_xref="taxon:8355"
                     /chromosome="7L"
                     /sex="female"
                     /tissue_type="Erythrocytes"
                     /dev_stage="adult"
                     /collection_date="06-Jul-2016"
                     /collected_by="Jessica Lyons"
     gene            1..1350
                     /gene="homeobox100496651-provisional.L"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 15 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:108696287"
                     /db_xref="Xenbase:XB-GENE-22065714"
     CDS             68..829
                     /gene="homeobox100496651-provisional.L"
                     /codon_start=1
                     /product="pituitary homeobox 3"
                     /protein_id="XP_018081018.1"
                     /db_xref="GeneID:108696287"
                     /db_xref="Xenbase:XB-GENE-22065714"
                     /translation="
MHAEREKIQDKDTQERGSSNHFHGKTRRRRTVYSQAHLDLLLSTFDTDPYPGIAVRERLSQLTGVHESRIQVWFQNRRARKKSVHERENVQNTNEWQQYNHISKTNKSSQAEWISKNNGHYKNQEFGFGNRSVNSYPYTNSSKSSALRFPLPFQWPKPMQASFNHLASVYPPRISDSRTQQHQVFIRQISTSHLTPAISILHSKDCVSQPESVSYGTMQEWSLEQMLEEFQPCWTNVADNFIDNINKVCHSVH"
     misc_feature    143..313
                     /gene="homeobox100496651-provisional.L"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(146..160,164..166,215..217,233..235,272..274,
                     278..283,290..295,299..307,311..313)
                     /gene="homeobox100496651-provisional.L"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(152..154,161..163,281..283,290..295,302..304)
                     /gene="homeobox100496651-provisional.L"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
acatgccagttgtgaaaagttactactggagagtatcaacacaaaaagcttagagaagaagctggagatgcatgcagaaagagagaaaatccaagacaaagacacccaagaaagaggtagctccaaccactttcatgggaaaacaagaaggagacgaactgtatacagccaagcccaccttgatctcctgcttagcacatttgatacagacccatatcctggaatcgcagtgagagaaagactgtcacaactaactggtgtacatgaatcaagaatacaggtctggttccaaaatagaagagccaggaagaaaagtgtgcacgaaagagagaatgtacaaaacacaaatgaatggcaacaatacaatcatatttctaaaactaacaagtcatcacaggctgaatggatttccaaaaacaatggacattataaaaaccaggaattcggatttggaaatcgctctgttaactcgtacccttataccaattcttccaaatccagtgcgctgagatttccccttccatttcagtggccaaaaccaatgcaggcatcattcaaccatctggcctcggtatacccaccaagaatatctgatagcagaacacagcaacatcaagtgtttatcaggcaaatatctaccagccaccttacacctgctatcagtattctccattctaaagattgtgttagtcaaccagagtctgtttcttatggcacaatgcaagaatggtccttggaacagatgttggaagaattccagccttgttggacaaatgtggcagataattttattgataatataaacaaagtctgccattcagtgcattaaggaagagggcagttataattttttaccaagagcttattctaacaatgttagttttagtacaattacagaagttgtgtaatattagcacaaacatttctgcaggtttaatcagctgtagcatttactgttacctgtttaaatacaaacatattgttagttgttatgggttactgcacctgtgcaaactttgtgacttttattatatatgggggatatgtgttttataactcatgttgaaaagggccagagatcattgtgggaaaaaggatgactgtaattactataaaggactgagcaaactgcaagtgtgattgtttagtaactgcaatggattgcaaatgtgtttaatgaaaccctttgaaatcctattacttgcaccaaaacacggcagtctataaagcaagtacatcatctaacaataatcagtctcattttactacatatctgtagttctgaccatatgtgatgctgcagaatattgtgtattttataaataaagatatttttacattaatttcttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]