2024-04-26 07:41:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018071395 4846 bp mRNA linear VRT 29-JUL-2019 DEFINITION PREDICTED: Manacus vitellinus ATPase copper transporting beta (ATP7B), transcript variant X4, mRNA. ACCESSION XM_018071395 VERSION XM_018071395.1 DBLINK BioProject: PRJNA341382 KEYWORDS RefSeq. SOURCE Manacus vitellinus (golden-collared manakin) ORGANISM Manacus vitellinus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Manacus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_021940208.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Manacus vitellinus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4846 /organism="Manacus vitellinus" /mol_type="mRNA" /isolate="BGI_N305" /db_xref="taxon:328815" /chromosome="Unknown" /sex="female" /country="Panama" gene 1..4846 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 ESTs, 9 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:103762416" CDS 439..4734 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X4" /protein_id="XP_017926884.1" /db_xref="GeneID:103762416" /translation="
MKHNFAFDNMGYEESFETTPSSSSQERTVTINIVGMTCQSCVQAIEGRISKVKGIVSIKVSREQNNAVIKYLQLEISPDQICLEIQDMGFDANVAEEKLTTATINLSSLKEAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKRHINNLGYDCTIKSKSAPLKLGVLDLQRLQNANPKKTPASFEGDGLDPLVAEMSSTATVTVQIEGMHCKSCVRNIEGNISAVPGIKSIKVSLEQKCAVVEYSPDLITLSALQQAIESLPPGNFKVCLLNGSEANKGASPSPAFTGDLIKQPLQDPTCIVVIKIDGMTCNSCAQSIERTISERQGVQQVAVSLAGSTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTSTAEHRHQPNASKAAVQPRPSEPPHQGCVLDALPDSPHLDGSNQLSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPFEIAQLIQNLGFEATIIEDHAETEGHVDLLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEIIGPRDIIKIIKEIGFHASVARRDPNAHNLDHKKEIQQWKKSFLCSLLFGIPVLIIMIYMQIPNGEHHGSMVLERNLVPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHRMANMDVLIVLATTIAYVYSCVILIVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVTKKPGSTVIAGSINAHGSILVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINVDVIKKYFPNQSKHISKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITYGVPKVMRVLLLGDTAVISLKKILAVIGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILSTANQGLDNLDANRSGDSRAPLGDNAVITLLESRGPSPSHTYSVLIGNREWMRRNGLNIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLEPWMGSAAMAASSMSVLLSSLQLKCYKKPDTESYEARAQGHMKPLTPSQISVHIGMDDRRRDSSRLAPWDQISQVSFSSLASDKLPRRNGFVEEEGGKWSLLMNGGDEEQYI"
misc_feature 526..714 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(544..552,559..561) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 781..972 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(799..807,814..816) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1117..1293 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1135..1143,1150..1152) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1417..1608 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1435..1443,1450..1452) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1786..1974 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1801..1809,1816..1818) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2020..2202 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2029..2037,2044..2046) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2266..4407 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3259..3261,3265..3267,4336..4338) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3391..3399,3601..3603,3787..3795,3883..3885, 4003..4011,4069..4071,4078..4080,4087..4089,4144..4146, 4153..4155) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gtccaagactggatctccagtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatacagttgaaagacagcacggatgccagccccatagcaagcagtacacaaatgcaaagtccgctggagatcctctgaaagtaatctttgaaagcagatgttaatgatgagttatgcggtagaaactaatgagcattgtttcagctccacctctaataatacagagtggtgattcttaggaaggaaacatagtatttctccttttgaactgcaattgcttgagtagtttgacagaagttcataccagtttattctctggaataacagaaattgaagaaacattaaaaagtccttgtaggctttgtcaaacattgattctcctcctggctgtgagctggagcctacaatgaaacataattttgcttttgacaacatgggctacgaggagagctttgaaaccactccttcttcatcttcccaagaacgtactgtgacaatcaacattgtgggaatgacttgccaatcatgtgtgcaggcaatagaaggccggatttccaaggtgaagggcattgtgagtattaaagtctcccgtgaacagaacaatgctgttatcaagtatctgcagttggaaataagtccggatcagatttgcctggaaattcaggatatgggctttgatgccaacgtagcagaagagaagttgacaacagcaaccataaatctgtcgagcttgaaagaagcagtagttaagcttcgcgtagaaggtatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtagcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagacacatcaataacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgtccttgatctccagcgcttgcagaatgcaaaccccaagaagacaccagcaagttttgagggtgatgggctggatccactggttgctgagatgagtagcacagctacggtgactgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatcagctgttcctggaataaaaagtattaaagtgtctttggagcaaaaatgtgctgtggtagagtatagcccagatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaatggttcagaagcaaataaaggagcatctccatcacctgctttcacaggtgatctcatcaaacaaccactgcaagacccgacgtgcatagttgttattaagattgatggcatgacctgcaattcttgtgcacagtccatagaaaggaccatatcagagagacaaggagtgcaacaggtagcagtttctctagctggcagtactggaaccatacattatgatccagctgtcactaacggcgaagagttaagagctgccatagaagacatgggatttgatgcttcagtgctgacagatacctccactgcagaacataggcaccagcctaatgccagcaaagctgcagtgcagcctcgaccttcagagcctcctcaccaaggctgtgtcttggatgctcttccagacagtcctcaccttgatgggtcaaaccagctcagtggagcaacagctgaaaagtgttttttgcaaatcacaggcatgacctgtgcatcatgtgtgtctaccatcgaaagaaatctgcagaaagaagacggaattgtttcagtgttggtagcactgatggcaggcaaagcagaaataaaatacaagccagaattcatacagccttttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatagaagatcatgcagaaacagaagggcatgtggatcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattttatgcctcagttgcacttgcaacttgcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaaataatcaaggaaattggctttcatgcttctgtggctagaagagatccaaatgcacataacctggatcataaaaaggaaatacagcagtggaagaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcataatgatttatatgcaaatacccaatggtgagcaccatgggtctatggtgctggaacggaacctcgttcctggattatctattttgaatcttctcttctttatcctgtgcacttttgttcagtttcttggcggatggtatttttatgtacaagcttacaaatccctgaggcacaggatggccaatatggatgtgctcatcgtactggccacgacgattgcttatgtgtattcctgtgtgatcctgatagtggcgataattgaaaaggcagaggaaagccctgttactttctttgacactcctccaatgttgtttgtgttcattgcacttggcagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggaacaggtagctgttgaactggttcaaaggggtgatatcataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcaattcttgttaatgctactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatactttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaatgttgatgttattaaaaaatattttcctaatcagagcaaacacatttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtaatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgttgggagacacagctgtgatctccctgaagaagatactggcggttattggcactgcagaagccagcagtgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggcactcagagtctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaagtcggaggagttgaggccatcctcagcacagccaatcagggtctcgataatctggatgctaacaggagtggggacagcagggctcctctgggagataatgcggtgatcacgctcttggaatcacggggtccgtcaccatctcatacatactcagtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtgaatgatgcaatgacggaccatgaaacgaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcatacactgaaaagcatgggaatagatgtggtgctgataacgggggacaacagaaaaactgcgaaagccattgctactcaggttgggatcaaaaaagtgtttgccgaggttcttccttctcacaaggttgccaaggtccaggaactccaaaatgggaggaggaaggttgcaatggttggtgatggagtcaatgattcccctgcactagccagggctgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaacgacttgctggatgtagttgccagtattcatttatcgaagagaacagttcgaagaatacgaataaatctaattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttgagccttggatgggatcagctgcaatggcagcttcttctatgtctgtcctgctgtcttccctgcagctgaaatgttacaagaagccagacacagaaagttatgaagctcgagctcaaggccacatgaagccactcactccttctcaaatcagtgttcatattggaatggatgatagaagaagggattcttccagactggctccttgggatcagattagccaagtgtctttctcttccttggcttcagacaagctgccaagacgtaatggttttgttgaggaggaagggggaaagtggtcattgctcatgaatggaggagatgaggaacagtacatctgaagcagtgcattcttagtacagagaaatgtttctcttcaccagtgttgggagggattgacttgtttcatcaagagcttcaaggttgtaaatgaagttactccttcagctcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]