LOCUS       XM_018071394            4713 bp    mRNA    linear   VRT 29-JUL-2019
DEFINITION  PREDICTED: Manacus vitellinus ATPase copper transporting beta
            (ATP7B), transcript variant X3, mRNA.
ACCESSION   XM_018071394
VERSION     XM_018071394.1
DBLINK      BioProject: PRJNA341382
KEYWORDS    RefSeq.
SOURCE      Manacus vitellinus (golden-collared manakin)
  ORGANISM  Manacus vitellinus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Manacus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021940208.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Manacus vitellinus Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4713
                     /organism="Manacus vitellinus"
                     /mol_type="mRNA"
                     /isolate="BGI_N305"
                     /db_xref="taxon:328815"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Panama"
     gene            1..4713
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 ESTs, 9 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:103762416"
     CDS             222..4601
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_017926883.1"
                     /db_xref="GeneID:103762416"
                     /translation="

MGMPEVNTVERQALSNIDSPPGCELEPTMKHNFAFDNMGYEESFETTPSSSSQERTVTINIVGMTCQSCVQAIEGRISKVKGIVSIKVSREQNNAVIKYLQLEISPDQICLEIQDMGFDANVAEEKLTTATINLSSLKEAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKRHINNLGYDCTIKSKSAPLKLGVLDLQRLQNANPKKTPASFEGDGLDPLVAEMSSTATVTVQIEGMHCKSCVRNIEGNISAVPGIKSIKVSLEQKCAVVEYSPDLITLSALQQAIESLPPGNFKVCLLNGSEANKGASPSPAFTGDLIKQPLQDPTCIVVIKIDGMTCNSCAQSIERTISERQGVQQVAVSLAGSTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTSTAEHRHQPNASKAAVQPRPSEPPHQGCVLDALPDSPHLDGSNQLSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPFEIAQLIQNLGFEATIIEDHAETEGHVDLLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEIIGPRDIIKIIKEIGFHASVARRDPNAHNLDHKKEIQQWKKSFLCSLLFGIPVLIIMIYMQIPNGEHHGSMVLERNLVPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHRMANMDVLIVLATTIAYVYSCVILIVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVTKKPGSTVIAGSINAHGSILVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINVDVIKKYFPNQSKHISKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITYGVPKVMRVLLLGDTAVISLKKILAVIGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILSTANQGLDNLDANRSGDSRAPLGDNAVITLLESRGPSPSHTYSVLIGNREWMRRNGLNIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLEPWMGSAAMAASSMSVLLSSLQLKCYKKPDTESYEARAQGHMKPLTPSQISVHIGMDDRRRDSSRLAPWDQISQVSFSSLASDKLPRRNGFVEEEGGKWSLLMNGGDEEQYI"

     misc_feature    393..581
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(411..419,426..428)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    648..839
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(666..674,681..683)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    984..1160
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1002..1010,1017..1019)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1284..1475
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1302..1310,1317..1319)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1653..1841
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1668..1676,1683..1685)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1887..2069
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1896..1904,1911..1913)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2133..4274
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3126..3128,3132..3134,4203..4205)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3258..3266,3468..3470,3654..3662,3750..3752,
                     3870..3878,3936..3938,3945..3947,3954..3956,4011..4013,
                     4020..4022)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gttttcttagaaccgtggccaaagagttctttctgatttcatggctcaaaactaagaacaaatgtatttaaagagagagttttgttgcctcttcatacagaaagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaagactggatctccagtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatacagttgaaagacaggctttgtcaaacattgattctcctcctggctgtgagctggagcctacaatgaaacataattttgcttttgacaacatgggctacgaggagagctttgaaaccactccttcttcatcttcccaagaacgtactgtgacaatcaacattgtgggaatgacttgccaatcatgtgtgcaggcaatagaaggccggatttccaaggtgaagggcattgtgagtattaaagtctcccgtgaacagaacaatgctgttatcaagtatctgcagttggaaataagtccggatcagatttgcctggaaattcaggatatgggctttgatgccaacgtagcagaagagaagttgacaacagcaaccataaatctgtcgagcttgaaagaagcagtagttaagcttcgcgtagaaggtatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtagcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagacacatcaataacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgtccttgatctccagcgcttgcagaatgcaaaccccaagaagacaccagcaagttttgagggtgatgggctggatccactggttgctgagatgagtagcacagctacggtgactgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatcagctgttcctggaataaaaagtattaaagtgtctttggagcaaaaatgtgctgtggtagagtatagcccagatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaatggttcagaagcaaataaaggagcatctccatcacctgctttcacaggtgatctcatcaaacaaccactgcaagacccgacgtgcatagttgttattaagattgatggcatgacctgcaattcttgtgcacagtccatagaaaggaccatatcagagagacaaggagtgcaacaggtagcagtttctctagctggcagtactggaaccatacattatgatccagctgtcactaacggcgaagagttaagagctgccatagaagacatgggatttgatgcttcagtgctgacagatacctccactgcagaacataggcaccagcctaatgccagcaaagctgcagtgcagcctcgaccttcagagcctcctcaccaaggctgtgtcttggatgctcttccagacagtcctcaccttgatgggtcaaaccagctcagtggagcaacagctgaaaagtgttttttgcaaatcacaggcatgacctgtgcatcatgtgtgtctaccatcgaaagaaatctgcagaaagaagacggaattgtttcagtgttggtagcactgatggcaggcaaagcagaaataaaatacaagccagaattcatacagccttttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatagaagatcatgcagaaacagaagggcatgtggatcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattttatgcctcagttgcacttgcaacttgcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaaataatcaaggaaattggctttcatgcttctgtggctagaagagatccaaatgcacataacctggatcataaaaaggaaatacagcagtggaagaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcataatgatttatatgcaaatacccaatggtgagcaccatgggtctatggtgctggaacggaacctcgttcctggattatctattttgaatcttctcttctttatcctgtgcacttttgttcagtttcttggcggatggtatttttatgtacaagcttacaaatccctgaggcacaggatggccaatatggatgtgctcatcgtactggccacgacgattgcttatgtgtattcctgtgtgatcctgatagtggcgataattgaaaaggcagaggaaagccctgttactttctttgacactcctccaatgttgtttgtgttcattgcacttggcagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggaacaggtagctgttgaactggttcaaaggggtgatatcataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcaattcttgttaatgctactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatactttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaatgttgatgttattaaaaaatattttcctaatcagagcaaacacatttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtaatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgttgggagacacagctgtgatctccctgaagaagatactggcggttattggcactgcagaagccagcagtgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggcactcagagtctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaagtcggaggagttgaggccatcctcagcacagccaatcagggtctcgataatctggatgctaacaggagtggggacagcagggctcctctgggagataatgcggtgatcacgctcttggaatcacggggtccgtcaccatctcatacatactcagtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtgaatgatgcaatgacggaccatgaaacgaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcatacactgaaaagcatgggaatagatgtggtgctgataacgggggacaacagaaaaactgcgaaagccattgctactcaggttgggatcaaaaaagtgtttgccgaggttcttccttctcacaaggttgccaaggtccaggaactccaaaatgggaggaggaaggttgcaatggttggtgatggagtcaatgattcccctgcactagccagggctgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaacgacttgctggatgtagttgccagtattcatttatcgaagagaacagttcgaagaatacgaataaatctaattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttgagccttggatgggatcagctgcaatggcagcttcttctatgtctgtcctgctgtcttccctgcagctgaaatgttacaagaagccagacacagaaagttatgaagctcgagctcaaggccacatgaagccactcactccttctcaaatcagtgttcatattggaatggatgatagaagaagggattcttccagactggctccttgggatcagattagccaagtgtctttctcttccttggcttcagacaagctgccaagacgtaatggttttgttgaggaggaagggggaaagtggtcattgctcatgaatggaggagatgaggaacagtacatctgaagcagtgcattcttagtacagagaaatgtttctcttcaccagtgttgggagggattgacttgtttcatcaagagcttcaaggttgtaaatgaagttactccttcagctcata

//