2024-04-26 10:26:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018071392 4816 bp mRNA linear VRT 29-JUL-2019 DEFINITION PREDICTED: Manacus vitellinus ATPase copper transporting beta (ATP7B), transcript variant X1, mRNA. ACCESSION XM_018071392 VERSION XM_018071392.1 DBLINK BioProject: PRJNA341382 KEYWORDS RefSeq. SOURCE Manacus vitellinus (golden-collared manakin) ORGANISM Manacus vitellinus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Manacus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_021940208.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Manacus vitellinus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4816 /organism="Manacus vitellinus" /mol_type="mRNA" /isolate="BGI_N305" /db_xref="taxon:328815" /chromosome="Unknown" /sex="female" /country="Panama" gene 1..4816 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:103762416" CDS 112..4704 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X1" /protein_id="XP_017926881.1" /db_xref="GeneID:103762416" /translation="
MERKQDSKTKRELSYLATLNDRNITLMSIRKQQAAHDVPELLIIGEKSKTGSPVKASSNLQKEEKLLQSYSMGMPEVNTVERQALSNIDSPPGCELEPTMKHNFAFDNMGYEESFETTPSSSSQERTVTINIVGMTCQSCVQAIEGRISKVKGIVSIKVSREQNNAVIKYLQLEISPDQICLEIQDMGFDANVAEEKLTTATINLSSLKEAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKRHINNLGYDCTIKSKSAPLKLGVLDLQRLQNANPKKTPASFEGDGLDPLVAEMSSTATVTVQIEGMHCKSCVRNIEGNISAVPGIKSIKVSLEQKCAVVEYSPDLITLSALQQAIESLPPGNFKVCLLNGSEANKGASPSPAFTGDLIKQPLQDPTCIVVIKIDGMTCNSCAQSIERTISERQGVQQVAVSLAGSTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTSTAEHRHQPNASKAAVQPRPSEPPHQGCVLDALPDSPHLDGSNQLSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPFEIAQLIQNLGFEATIIEDHAETEGHVDLLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEIIGPRDIIKIIKEIGFHASVARRDPNAHNLDHKKEIQQWKKSFLCSLLFGIPVLIIMIYMQIPNGEHHGSMVLERNLVPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHRMANMDVLIVLATTIAYVYSCVILIVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVTKKPGSTVIAGSINAHGSILVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINVDVIKKYFPNQSKHISKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITYGVPKVMRVLLLGDTAVISLKKILAVIGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILSTANQGLDNLDANRSGDSRAPLGDNAVITLLESRGPSPSHTYSVLIGNREWMRRNGLNIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLEPWMGSAAMAASSMSVLLSSLQLKCYKKPDTESYEARAQGHMKPLTPSQISVHIGMDDRRRDSSRLAPWDQISQVSFSSLASDKLPRRNGFVEEEGGKWSLLMNGGDEEQYI"
misc_feature 496..684 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(514..522,529..531) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 751..942 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(769..777,784..786) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1087..1263 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1105..1113,1120..1122) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1387..1578 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1405..1413,1420..1422) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1756..1944 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1771..1779,1786..1788) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1990..2172 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1999..2007,2014..2016) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2236..4377 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3229..3231,3235..3237,4306..4308) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3361..3369,3571..3573,3757..3765,3853..3855, 3973..3981,4039..4041,4048..4050,4057..4059,4114..4116, 4123..4125) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
tctccaggctgttgtaaacgtagctgaaggaagtgtggctgataagacaccgaataaccgctcttgtaaagcttttgtttggcgctgcaatatttaaaatccagaaagataatggagagaaaacaggacagtaaaacgaaaagggaactgtcctacttagctactttaaacgacagaaacataaccctgatgtctattcgtaagcagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaagactggatctccagtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatacagttgaaagacaggctttgtcaaacattgattctcctcctggctgtgagctggagcctacaatgaaacataattttgcttttgacaacatgggctacgaggagagctttgaaaccactccttcttcatcttcccaagaacgtactgtgacaatcaacattgtgggaatgacttgccaatcatgtgtgcaggcaatagaaggccggatttccaaggtgaagggcattgtgagtattaaagtctcccgtgaacagaacaatgctgttatcaagtatctgcagttggaaataagtccggatcagatttgcctggaaattcaggatatgggctttgatgccaacgtagcagaagagaagttgacaacagcaaccataaatctgtcgagcttgaaagaagcagtagttaagcttcgcgtagaaggtatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtagcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagacacatcaataacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgtccttgatctccagcgcttgcagaatgcaaaccccaagaagacaccagcaagttttgagggtgatgggctggatccactggttgctgagatgagtagcacagctacggtgactgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatcagctgttcctggaataaaaagtattaaagtgtctttggagcaaaaatgtgctgtggtagagtatagcccagatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaatggttcagaagcaaataaaggagcatctccatcacctgctttcacaggtgatctcatcaaacaaccactgcaagacccgacgtgcatagttgttattaagattgatggcatgacctgcaattcttgtgcacagtccatagaaaggaccatatcagagagacaaggagtgcaacaggtagcagtttctctagctggcagtactggaaccatacattatgatccagctgtcactaacggcgaagagttaagagctgccatagaagacatgggatttgatgcttcagtgctgacagatacctccactgcagaacataggcaccagcctaatgccagcaaagctgcagtgcagcctcgaccttcagagcctcctcaccaaggctgtgtcttggatgctcttccagacagtcctcaccttgatgggtcaaaccagctcagtggagcaacagctgaaaagtgttttttgcaaatcacaggcatgacctgtgcatcatgtgtgtctaccatcgaaagaaatctgcagaaagaagacggaattgtttcagtgttggtagcactgatggcaggcaaagcagaaataaaatacaagccagaattcatacagccttttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatagaagatcatgcagaaacagaagggcatgtggatcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattttatgcctcagttgcacttgcaacttgcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaaataatcaaggaaattggctttcatgcttctgtggctagaagagatccaaatgcacataacctggatcataaaaaggaaatacagcagtggaagaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcataatgatttatatgcaaatacccaatggtgagcaccatgggtctatggtgctggaacggaacctcgttcctggattatctattttgaatcttctcttctttatcctgtgcacttttgttcagtttcttggcggatggtatttttatgtacaagcttacaaatccctgaggcacaggatggccaatatggatgtgctcatcgtactggccacgacgattgcttatgtgtattcctgtgtgatcctgatagtggcgataattgaaaaggcagaggaaagccctgttactttctttgacactcctccaatgttgtttgtgttcattgcacttggcagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactctattgtcagggaggaacaggtagctgttgaactggttcaaaggggtgatatcataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcaattcttgttaatgctactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatactttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaatgttgatgttattaaaaaatattttcctaatcagagcaaacacatttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtaatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgttgggagacacagctgtgatctccctgaagaagatactggcggttattggcactgcagaagccagcagtgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggcactcagagtctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaagtcggaggagttgaggccatcctcagcacagccaatcagggtctcgataatctggatgctaacaggagtggggacagcagggctcctctgggagataatgcggtgatcacgctcttggaatcacggggtccgtcaccatctcatacatactcagtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtgaatgatgcaatgacggaccatgaaacgaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcatacactgaaaagcatgggaatagatgtggtgctgataacgggggacaacagaaaaactgcgaaagccattgctactcaggttgggatcaaaaaagtgtttgccgaggttcttccttctcacaaggttgccaaggtccaggaactccaaaatgggaggaggaaggttgcaatggttggtgatggagtcaatgattcccctgcactagccagggctgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaacgacttgctggatgtagttgccagtattcatttatcgaagagaacagttcgaagaatacgaataaatctaattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttgagccttggatgggatcagctgcaatggcagcttcttctatgtctgtcctgctgtcttccctgcagctgaaatgttacaagaagccagacacagaaagttatgaagctcgagctcaaggccacatgaagccactcactccttctcaaatcagtgttcatattggaatggatgatagaagaagggattcttccagactggctccttgggatcagattagccaagtgtctttctcttccttggcttcagacaagctgccaagacgtaatggttttgttgaggaggaagggggaaagtggtcattgctcatgaatggaggagatgaggaacagtacatctgaagcagtgcattcttagtacagagaaatgtttctcttcaccagtgttgggagggattgacttgtttcatcaagagcttcaaggttgtaaatgaagttactccttcagctcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]