2024-04-20 18:04:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_018056700 5039 bp mRNA linear MAM 08-SEP-2016 DEFINITION PREDICTED: Capra hircus ATPase copper transporting beta (ATP7B), transcript variant X3, mRNA. ACCESSION XM_018056700 VERSION XM_018056700.1 DBLINK BioProject: PRJNA340281 KEYWORDS RefSeq. SOURCE Capra hircus (goat) ORGANISM Capra hircus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia; Pecora; Bovidae; Caprinae; Capra. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_030819.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Capra hircus Annotation Release 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..5039 /organism="Capra hircus" /mol_type="mRNA" /db_xref="taxon:9925" /chromosome="12" /sex="male" /tissue_type="blood" /dev_stage="adult" /breed="San Clemente" gene 1..5039 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins, and 99% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:102183524" CDS 484..4818 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X3" /protein_id="XP_017912189.1" /db_xref="GeneID:102183524" /translation="
MKPEDERPIIDREKASRRILSKLFQPAMKQSFAFDNNGYEDDLDGVCPSQTAAGTISIVGMTCQSCVKSIEGRVSSLKGIVSIKVSLEQGSAEVRYVPSVVSLMQICHQIEDMGFQASVAEGKATSWASRVSPTSEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSNQEAVITYQPYLIQPQDLRDHITDMGFEAVIKNKVAPVSLGPIDVRRLQSTLSAAPPTPVNQNDNNSETPGGQGVPLHLRVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLESRTAQVQYDPSLVSPGALQRAIEALPPGNFKVSFPNGAEGSGPDSRTPPAPSAPCTMMLAIAGMTCKSCVQSIEGLISQRAGVHQISVFLAEGTAVVLYDPSRTHPEELRAAVEDMGFEASILAENCSSNQVGNHSAGSAMGPAAAGTPVPMQEEAPQPGGLHTNHIPRQSPKSLPASTTVAPKKCFLQISGMTCASCVSNIERNLQKEPGILSVLVALMAGKAEVKYNPEAIQPLEIAKLVQDLGFEAAVMEDYTGSDGDLELMITGMTCASCVHNIESKLRRTEGITYASVALATSKAHVKFDPEIIGPRDIVKLIEEIGFRASLAQRIPNAHHLDHKVEIKQWKNSFLCSLVFGIPVMGLMIYMLIPSHEPQSSVLDHNVVPGLSILNLVFFILCTFVQFLGGWYFYVQAYKSLRHGMANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVVKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVLMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSMVIAGSMNAHGSVLITATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTVTLVVWIVIGFIDFGVVQKYFPAPSKGISQAEVVLRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVSRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTRHCKEELGTETLGCCMDFQAVPGCGISCKVSNVESILAQGERPQGPPTAHQNRVGSEPSETDAATQTFSVLIGNREWMRRNGLTVTSDVRDAMTDHETKGQTAILVAIDGVLCGMIAVADSVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNQGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSRRTVWRIRLNLVLALIYNLIGIPVAAGVFIPIGVVLQPWMGSAAMAASSVSVVLSSLQLKCYRKPDLAQYEAQAHGHMKPLSASQVSVRVGMDDRRRDSPRASAWDQVSYVSQVSLSPLKSDKLSRHSGAADDRGDKWSLLLNDRDEEQGI"
misc_feature 646..837 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(664..672,679..681) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 901..1089 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(919..927,934..936) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1237..1410 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1252..1260,1267..1269) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1507..1698 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1525..1533,1540..1542) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1897..2085 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1912..1920,1927..1929) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2122..2313 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2140..2148,2155..2157) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2377..4482 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3367..3369,3373..3375,4411..4413) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3499..3507,3709..3711,3862..3870,3958..3960, 4078..4086,4144..4146,4153..4155,4162..4164,4219..4221, 4228..4230) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gggggagttgggcatagggagggcgtggcctgtgatggacagtcggtgcacccgccctcggccccctcccccaccgaagcccccgctcgggtgccccagcccctattctagagtcccgccgctggtcggaaaccaatgggaggctcttgcgcgtctgggatcgattttccaggtgcggagttcacaaccgcagcagctgcagcgtttctgatccgcggcgccctggagtcaggcgcggagccccagagggagttgcgcagagcggacccgactgtgacccccgccacgccgcaccttcccggccggcagtgggcgagcctggggatctgcatctccggcccgggtctacgcggctcgccctggctccttctctcccttggcacacgcccaaggctgaagacagaccgaggcgagagcgcaccggtccaggaggtgaccttgggctccgggctgaatcatagaagaaattagttactccgcgagatgaagccagaggacgagagaccgattatagatcgcgaaaaggccagtcggagaatcctgtctaagcttttccagccagcaatgaagcagagctttgcctttgacaacaatggctacgaggatgacctggatggcgtgtgcccctcccagacggccgctggcaccatcagcattgtgggcatgacctgccagtcgtgtgtcaagtccatcgagggcagggtctccagtttgaaaggcattgtgagcattaaggtttccctggagcagggcagtgctgaggtgagatacgtgccctcagtggtaagcctgatgcagatttgccatcagattgaagacatgggcttccaggccagtgtggccgagggaaaggccacctcctgggcctccagggtctcgcccacctcggaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcagggcgtcgtgagggtccgcgtctcgctcagcaaccaggaggcagtcatcacttaccagccttaccttatccaaccccaagacctcagggaccatataaccgatatggggtttgaagccgtcatcaagaacaaggtggccccagtaagcctgggacccatagacgtcaggcgactccagagcaccctctcagcggcccctccaactcccgttaatcagaatgacaataactctgagaccccagggggccagggggtccccctgcacctgagagtggatggaatgcactgtaagtcttgtgtcctgaacattgaagacaatatcggccagctccccggggttcagagtattcacgtgtccctggagagcaggaccgcccaagtccagtacgacccttctctcgtctccccaggggccctgcagagggccatcgaggccctgcctcctgggaactttaaagtctcttttcccaatggggcggaagggagtgggccagactccaggacccccccggcacccagtgcgccctgtaccatgatgctggccattgctggcatgacctgtaagtcctgcgtccagtccatcgaaggcctgatctcccagagggcgggcgtgcaccagatctcagtctttttggccgaaggaactgcagtggttctctatgatccatctcgaactcacccagaagaactgcgagccgcggtggaggacatgggattcgaggcctccatcctggctgaaaactgttccagcaaccaggttggcaaccacagtgctgggagtgccatggggcctgcggcagctggcacacctgtgcccatgcaggaagaggctccccagccaggggggctccacactaaccacatcccccgccagtcgcccaagtccctcccggcctccaccacggtggccccaaagaagtgcttcctacagatctcaggcatgacctgtgcgtcctgtgtgtccaacatagagaggaacctgcagaaagaacctgggatcctgtctgtgctggttgccctgatggcaggaaaggcagaggtgaagtacaacccggaagccatccagcccctggagatagcaaagctcgtccaggacctgggctttgaggcagcagtgatggaagactacacgggctcggatggcgacctcgagctgatgatcacggggatgacctgcgcctcctgtgttcacaacatagagtccaaactcaggaggacagaaggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaattattggtccgcgggatattgtcaaacttatcgaggaaattggctttcgtgcctccctggcccagaggatccccaacgctcatcacttggaccacaaggtggaaataaagcagtggaagaactctttcctgtgcagcctggtgtttggcatccccgtcatgggtttaatgatctatatgttgatacccagccatgagcctcagtcctcagtccttgaccacaacgtcgtcccaggactgtccatcctgaatctcgtcttctttatcttgtgcacctttgtgcagttccttggcggctggtacttctatgtccaggcctacaaatctctgagacacgggatggccaacatggacgtgctcatcgtgctggccacgagcatcgcctacgtctactccctcgtcatcctggtggtggccgtggccgagaaggccgagaggagccccgtgaccttctttgacacgccccccatgctcttcgtcttcatcgccctggggcggtggctggaacacgtggtgaagagcaaaacctcagaagcgcttgccaaactcatgtctctgcaagccacggaagccaccgtcgtgacccttggtgaagacaacgtgatcatcagggaggagcaggtgctcatggagctggtgcaacgaggtgacatcatcaaggtggtccccgggggcaagtttcccgtggacgggaaagtcctagaaggcaacaccatggccgacgagtccctcatcacaggagaggccatgcctgtcaccaagaagcccggaagcatggtaatcgccgggtccatgaacgcccatggctctgtgctcatcactgccacccacgtgggcaatgataccaccttggcccagattgtgaagctagtggaagaggcccagatgtccaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactgtgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagaaatactttcctgcccccagcaagggcatctcccaggccgaggtggtcctgcggttcgcgttccagacgtccatcacggtgctctgcatcgcctgcccctgctcgctgggcctggccacgcccacggccgtcatggtgggcaccggggtggccgcccagaacggcatcctcatcaagggcggcaagcccctggagatggcccacaagataaagaccgtgatgttcgacaaaaccggcaccattacccacggggtccccaaagtctcgagggtcctcctgctcgtggacgtggccacgctgcccctgcggaaggtgcttgctgtggtggggaccgcggaggccagcagtgagcaccccctgggcgtggcagtgaccagacactgtaaagaggaacttggcacggagaccctggggtgctgcatggacttccaggcggtgcccggctgtggaatcagctgcaaagtcagcaacgtggagagcatccttgcccagggcgagcgcccgcagggcccaccaactgctcaccagaacagagtcggcagcgagccctcagaaacagacgcagccactcagaccttctctgtgctgatcggaaaccgggaatggatgaggcgcaacggcctgaccgtcaccagcgacgtccgcgacgccatgaccgaccacgagacaaagggccagacggccatcctggtcgccatcgatggtgtactgtgcggcatgatcgccgtcgcggactcggtcaagcaggaggccgccctggccgtgcacacgctgaagagcatgggcgtggacgtggtgctcatcaccggggacaaccgcaagacagccagggccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaagtccaggagctgcagaaccaggggaagagagtggccatggtgggcgacggcgtgaacgactccccagccctggcgcaggctgacgtgggcattgccatcggcacgggcactgacgtggccatcgaggcggccgacgtcgtcctcatcaggaatgacctgctcgatgtggtggccagcatccacctctccaggaggaccgtctggagaatacggctcaacctggtgctggcgctgatctacaacctgatcgggatccccgtcgcggcaggtgtcttcatacccattggcgtcgtgctgcagccgtggatgggctcagcggccatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctacaggaagccggacctggcgcagtacgaggcgcaggcgcacggccacatgaagcccctgagcgcgtcgcaggtcagcgtgcgcgttggcatggacgaccgccggcgcgactccccgcgggcctcggcctgggaccaggtcagctacgtcagccaggtgtccctgtcccccctcaagtccgacaagctgtcccggcacagtggcgcggccgacgacaggggcgacaagtggtctctgcttctgaatgaccgggacgaggagcagggcatctgaaagccgcccccgcggctgaggctcccagcccgcagcggcagcagcaggcggccgagcccctccaggcctaggcgaacattctggatcaccccttccctgcgcccgggggcgcgattccccgggttccatgggctcaggggaaggcgtgcttgcctacgcgctcgtgggctcatcggacaccttgctgcggcctcaagaagaggaaggacaagccctcctcg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]