GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 18:04:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_018056700            5039 bp    mRNA    linear   MAM 08-SEP-2016
DEFINITION  PREDICTED: Capra hircus ATPase copper transporting beta (ATP7B),
            transcript variant X3, mRNA.
ACCESSION   XM_018056700
VERSION     XM_018056700.1
DBLINK      BioProject: PRJNA340281
KEYWORDS    RefSeq.
SOURCE      Capra hircus (goat)
  ORGANISM  Capra hircus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Caprinae; Capra.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030819.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Capra hircus Annotation Release 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5039
                     /organism="Capra hircus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9925"
                     /chromosome="12"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /breed="San Clemente"
     gene            1..5039
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, 3 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 4 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102183524"
     CDS             484..4818
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_017912189.1"
                     /db_xref="GeneID:102183524"
                     /translation="
MKPEDERPIIDREKASRRILSKLFQPAMKQSFAFDNNGYEDDLDGVCPSQTAAGTISIVGMTCQSCVKSIEGRVSSLKGIVSIKVSLEQGSAEVRYVPSVVSLMQICHQIEDMGFQASVAEGKATSWASRVSPTSEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSNQEAVITYQPYLIQPQDLRDHITDMGFEAVIKNKVAPVSLGPIDVRRLQSTLSAAPPTPVNQNDNNSETPGGQGVPLHLRVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLESRTAQVQYDPSLVSPGALQRAIEALPPGNFKVSFPNGAEGSGPDSRTPPAPSAPCTMMLAIAGMTCKSCVQSIEGLISQRAGVHQISVFLAEGTAVVLYDPSRTHPEELRAAVEDMGFEASILAENCSSNQVGNHSAGSAMGPAAAGTPVPMQEEAPQPGGLHTNHIPRQSPKSLPASTTVAPKKCFLQISGMTCASCVSNIERNLQKEPGILSVLVALMAGKAEVKYNPEAIQPLEIAKLVQDLGFEAAVMEDYTGSDGDLELMITGMTCASCVHNIESKLRRTEGITYASVALATSKAHVKFDPEIIGPRDIVKLIEEIGFRASLAQRIPNAHHLDHKVEIKQWKNSFLCSLVFGIPVMGLMIYMLIPSHEPQSSVLDHNVVPGLSILNLVFFILCTFVQFLGGWYFYVQAYKSLRHGMANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVVKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVLMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSMVIAGSMNAHGSVLITATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTVTLVVWIVIGFIDFGVVQKYFPAPSKGISQAEVVLRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVSRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTRHCKEELGTETLGCCMDFQAVPGCGISCKVSNVESILAQGERPQGPPTAHQNRVGSEPSETDAATQTFSVLIGNREWMRRNGLTVTSDVRDAMTDHETKGQTAILVAIDGVLCGMIAVADSVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNQGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSRRTVWRIRLNLVLALIYNLIGIPVAAGVFIPIGVVLQPWMGSAAMAASSVSVVLSSLQLKCYRKPDLAQYEAQAHGHMKPLSASQVSVRVGMDDRRRDSPRASAWDQVSYVSQVSLSPLKSDKLSRHSGAADDRGDKWSLLLNDRDEEQGI"
     misc_feature    646..837
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(664..672,679..681)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    901..1089
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(919..927,934..936)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1237..1410
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1252..1260,1267..1269)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1507..1698
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1525..1533,1540..1542)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1897..2085
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1912..1920,1927..1929)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2122..2313
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2140..2148,2155..2157)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2377..4482
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3367..3369,3373..3375,4411..4413)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3499..3507,3709..3711,3862..3870,3958..3960,
                     4078..4086,4144..4146,4153..4155,4162..4164,4219..4221,
                     4228..4230)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
gggggagttgggcatagggagggcgtggcctgtgatggacagtcggtgcacccgccctcggccccctcccccaccgaagcccccgctcgggtgccccagcccctattctagagtcccgccgctggtcggaaaccaatgggaggctcttgcgcgtctgggatcgattttccaggtgcggagttcacaaccgcagcagctgcagcgtttctgatccgcggcgccctggagtcaggcgcggagccccagagggagttgcgcagagcggacccgactgtgacccccgccacgccgcaccttcccggccggcagtgggcgagcctggggatctgcatctccggcccgggtctacgcggctcgccctggctccttctctcccttggcacacgcccaaggctgaagacagaccgaggcgagagcgcaccggtccaggaggtgaccttgggctccgggctgaatcatagaagaaattagttactccgcgagatgaagccagaggacgagagaccgattatagatcgcgaaaaggccagtcggagaatcctgtctaagcttttccagccagcaatgaagcagagctttgcctttgacaacaatggctacgaggatgacctggatggcgtgtgcccctcccagacggccgctggcaccatcagcattgtgggcatgacctgccagtcgtgtgtcaagtccatcgagggcagggtctccagtttgaaaggcattgtgagcattaaggtttccctggagcagggcagtgctgaggtgagatacgtgccctcagtggtaagcctgatgcagatttgccatcagattgaagacatgggcttccaggccagtgtggccgagggaaaggccacctcctgggcctccagggtctcgcccacctcggaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgtgtcagctccatagaaggcaagatcgggaaactgcagggcgtcgtgagggtccgcgtctcgctcagcaaccaggaggcagtcatcacttaccagccttaccttatccaaccccaagacctcagggaccatataaccgatatggggtttgaagccgtcatcaagaacaaggtggccccagtaagcctgggacccatagacgtcaggcgactccagagcaccctctcagcggcccctccaactcccgttaatcagaatgacaataactctgagaccccagggggccagggggtccccctgcacctgagagtggatggaatgcactgtaagtcttgtgtcctgaacattgaagacaatatcggccagctccccggggttcagagtattcacgtgtccctggagagcaggaccgcccaagtccagtacgacccttctctcgtctccccaggggccctgcagagggccatcgaggccctgcctcctgggaactttaaagtctcttttcccaatggggcggaagggagtgggccagactccaggacccccccggcacccagtgcgccctgtaccatgatgctggccattgctggcatgacctgtaagtcctgcgtccagtccatcgaaggcctgatctcccagagggcgggcgtgcaccagatctcagtctttttggccgaaggaactgcagtggttctctatgatccatctcgaactcacccagaagaactgcgagccgcggtggaggacatgggattcgaggcctccatcctggctgaaaactgttccagcaaccaggttggcaaccacagtgctgggagtgccatggggcctgcggcagctggcacacctgtgcccatgcaggaagaggctccccagccaggggggctccacactaaccacatcccccgccagtcgcccaagtccctcccggcctccaccacggtggccccaaagaagtgcttcctacagatctcaggcatgacctgtgcgtcctgtgtgtccaacatagagaggaacctgcagaaagaacctgggatcctgtctgtgctggttgccctgatggcaggaaaggcagaggtgaagtacaacccggaagccatccagcccctggagatagcaaagctcgtccaggacctgggctttgaggcagcagtgatggaagactacacgggctcggatggcgacctcgagctgatgatcacggggatgacctgcgcctcctgtgttcacaacatagagtccaaactcaggaggacagaaggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaattattggtccgcgggatattgtcaaacttatcgaggaaattggctttcgtgcctccctggcccagaggatccccaacgctcatcacttggaccacaaggtggaaataaagcagtggaagaactctttcctgtgcagcctggtgtttggcatccccgtcatgggtttaatgatctatatgttgatacccagccatgagcctcagtcctcagtccttgaccacaacgtcgtcccaggactgtccatcctgaatctcgtcttctttatcttgtgcacctttgtgcagttccttggcggctggtacttctatgtccaggcctacaaatctctgagacacgggatggccaacatggacgtgctcatcgtgctggccacgagcatcgcctacgtctactccctcgtcatcctggtggtggccgtggccgagaaggccgagaggagccccgtgaccttctttgacacgccccccatgctcttcgtcttcatcgccctggggcggtggctggaacacgtggtgaagagcaaaacctcagaagcgcttgccaaactcatgtctctgcaagccacggaagccaccgtcgtgacccttggtgaagacaacgtgatcatcagggaggagcaggtgctcatggagctggtgcaacgaggtgacatcatcaaggtggtccccgggggcaagtttcccgtggacgggaaagtcctagaaggcaacaccatggccgacgagtccctcatcacaggagaggccatgcctgtcaccaagaagcccggaagcatggtaatcgccgggtccatgaacgcccatggctctgtgctcatcactgccacccacgtgggcaatgataccaccttggcccagattgtgaagctagtggaagaggcccagatgtccaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactgtgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagaaatactttcctgcccccagcaagggcatctcccaggccgaggtggtcctgcggttcgcgttccagacgtccatcacggtgctctgcatcgcctgcccctgctcgctgggcctggccacgcccacggccgtcatggtgggcaccggggtggccgcccagaacggcatcctcatcaagggcggcaagcccctggagatggcccacaagataaagaccgtgatgttcgacaaaaccggcaccattacccacggggtccccaaagtctcgagggtcctcctgctcgtggacgtggccacgctgcccctgcggaaggtgcttgctgtggtggggaccgcggaggccagcagtgagcaccccctgggcgtggcagtgaccagacactgtaaagaggaacttggcacggagaccctggggtgctgcatggacttccaggcggtgcccggctgtggaatcagctgcaaagtcagcaacgtggagagcatccttgcccagggcgagcgcccgcagggcccaccaactgctcaccagaacagagtcggcagcgagccctcagaaacagacgcagccactcagaccttctctgtgctgatcggaaaccgggaatggatgaggcgcaacggcctgaccgtcaccagcgacgtccgcgacgccatgaccgaccacgagacaaagggccagacggccatcctggtcgccatcgatggtgtactgtgcggcatgatcgccgtcgcggactcggtcaagcaggaggccgccctggccgtgcacacgctgaagagcatgggcgtggacgtggtgctcatcaccggggacaaccgcaagacagccagggccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaagtccaggagctgcagaaccaggggaagagagtggccatggtgggcgacggcgtgaacgactccccagccctggcgcaggctgacgtgggcattgccatcggcacgggcactgacgtggccatcgaggcggccgacgtcgtcctcatcaggaatgacctgctcgatgtggtggccagcatccacctctccaggaggaccgtctggagaatacggctcaacctggtgctggcgctgatctacaacctgatcgggatccccgtcgcggcaggtgtcttcatacccattggcgtcgtgctgcagccgtggatgggctcagcggccatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctacaggaagccggacctggcgcagtacgaggcgcaggcgcacggccacatgaagcccctgagcgcgtcgcaggtcagcgtgcgcgttggcatggacgaccgccggcgcgactccccgcgggcctcggcctgggaccaggtcagctacgtcagccaggtgtccctgtcccccctcaagtccgacaagctgtcccggcacagtggcgcggccgacgacaggggcgacaagtggtctctgcttctgaatgaccgggacgaggagcagggcatctgaaagccgcccccgcggctgaggctcccagcccgcagcggcagcagcaggcggccgagcccctccaggcctaggcgaacattctggatcaccccttccctgcgcccgggggcgcgattccccgggttccatgggctcaggggaaggcgtgcttgcctacgcgctcgtgggctcatcggacaccttgctgcggcctcaagaagaggaaggacaagccctcctcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]